EMAIL THIS PAGE TO A FRIEND

C5AR1

complement component 5a receptor 1

53 Gene Product Result for
Synonyms: C5A C5AR C5R1 CD88
UniProtKB ID: P21730
Gene ID:
Mouse(12273) complement component 5a receptor 1
Rat(113959) complement component 5a receptor 1
sheep(101118296) complement component 5a receptor 1
naked mole-rat(101713576) complement component 5a receptor 1
domestic guinea pig(100135489) complement component 5a receptor 1
Zebrafish(100000959) C5a anaphylatoxin chemotactic receptor
dog(442974) complement component 5a receptor 1
cow(493645) complement component 5a receptor 1
domestic cat(101098593) complement component 5a receptor 1
chicken(430484) complement component 5a receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021841 MISSION® esiRNA esiRNA human C5AR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001736 Rosetta Predictions human pricing
NM_053619 Rosetta Predictions rat pricing
NM_007577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021440 predicted 685
2 SASI_Hs01_00021441 predicted 1030
3 SASI_Hs01_00021442 predicted 315
4 SASI_Hs01_00021443 predicted 783
5 SASI_Hs01_00021444 predicted 247
6 SASI_Hs01_00021445 predicted 682
7 SASI_Hs01_00021446 predicted 259
8 SASI_Hs01_00021447 predicted 1045
9 SASI_Hs01_00021448 predicted 1002
10 SASI_Hs01_00021449 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068267 predicted 1469
2 SASI_Rn01_00068268 predicted 315
3 SASI_Rn01_00068269 predicted 247
4 SASI_Rn01_00068270 predicted 1459
5 SASI_Rn01_00068271 predicted 516
6 SASI_Rn01_00068272 predicted 659
7 SASI_Rn01_00068273 predicted 555
8 SASI_Rn01_00068274 predicted 753
9 SASI_Rn01_00068275 predicted 324
10 SASI_Rn02_00266324 predicted 598
11 SASI_Rn01_00068276 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051858 predicted 820
2 SASI_Mm01_00051859 predicted 651
3 SASI_Mm01_00051860 predicted 210
4 SASI_Mm01_00051861 predicted 261
5 SASI_Mm01_00051862 predicted 612
6 SASI_Mm01_00051863 predicted 368
7 SASI_Mm01_00051864 predicted 284
8 SASI_Mm01_00051865 predicted 510
9 SASI_Mm01_00051866 predicted 629
10 SASI_Mm02_00311964 predicted 424
11 SASI_Mm01_00051857 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001736
C5AR1 MISSION shRNA Bacterial Glycerol Stock
complement component 5a receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1385s21c1
Sequence:CCGGCCCGTGTATCTGGGATATTTCCTCGAGGAAATATCCCAGATACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-618s21c1
Sequence:CCGGTGGACTACAGCCACGACAAACCTCGAGGTTTGTCGTGGCTGTAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1449s21c1
Sequence:CCGGGTAGAAAGATTCTCGCTTAAACTCGAGTTTAAGCGAGAATCTTTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-691s21c1
Sequence:CCGGTCTACTCACGCTCACGATTTGCTCGAGCAAATCGTGAGCGTGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001736.1-2173s1c1
Sequence:CCGGCCAGGAATCCACTCTCCATTTCTCGAGAAATGGAGAGTGGATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-292s1c1
Sequence:CCGGCCCATCTTGTTCACGTCCATTCTCGAGAATGGACGTGAACAAGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-674s1c1
Sequence:CCGGCGCTCACGATTTGTTACACTTCTCGAGAAGTGTAACAAATCGTGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-420s1c1
Sequence:CCGGCGACCGCTTTCTGCTGGTGTTCTCGAGAACACCAGCAGAAAGCGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-888s1c1
Sequence:CCGGTGCCTACATCAACTGCTGCATCTCGAGATGCAGCAGTTGATGTAGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001736
C5AR1 MISSION shRNA shRNA Plasmid DNA
complement component 5a receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1385s21c1
Sequence:CCGGCCCGTGTATCTGGGATATTTCCTCGAGGAAATATCCCAGATACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-618s21c1
Sequence:CCGGTGGACTACAGCCACGACAAACCTCGAGGTTTGTCGTGGCTGTAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1449s21c1
Sequence:CCGGGTAGAAAGATTCTCGCTTAAACTCGAGTTTAAGCGAGAATCTTTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-691s21c1
Sequence:CCGGTCTACTCACGCTCACGATTTGCTCGAGCAAATCGTGAGCGTGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001736.1-2173s1c1
Sequence:CCGGCCAGGAATCCACTCTCCATTTCTCGAGAAATGGAGAGTGGATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-292s1c1
Sequence:CCGGCCCATCTTGTTCACGTCCATTCTCGAGAATGGACGTGAACAAGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-674s1c1
Sequence:CCGGCGCTCACGATTTGTTACACTTCTCGAGAAGTGTAACAAATCGTGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-420s1c1
Sequence:CCGGCGACCGCTTTCTGCTGGTGTTCTCGAGAACACCAGCAGAAAGCGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-888s1c1
Sequence:CCGGTGCCTACATCAACTGCTGCATCTCGAGATGCAGCAGTTGATGTAGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001736
C5AR1 MISSION shRNA Lentiviral Transduction Particles
complement component 5a receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1385s21c1
Sequence:CCGGCCCGTGTATCTGGGATATTTCCTCGAGGAAATATCCCAGATACACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-618s21c1
Sequence:CCGGTGGACTACAGCCACGACAAACCTCGAGGTTTGTCGTGGCTGTAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001736.3-1449s21c1
Sequence:CCGGGTAGAAAGATTCTCGCTTAAACTCGAGTTTAAGCGAGAATCTTTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001736.3-691s21c1
Sequence:CCGGTCTACTCACGCTCACGATTTGCTCGAGCAAATCGTGAGCGTGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001736.1-2173s1c1
Sequence:CCGGCCAGGAATCCACTCTCCATTTCTCGAGAAATGGAGAGTGGATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-292s1c1
Sequence:CCGGCCCATCTTGTTCACGTCCATTCTCGAGAATGGACGTGAACAAGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-674s1c1
Sequence:CCGGCGCTCACGATTTGTTACACTTCTCGAGAAGTGTAACAAATCGTGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-420s1c1
Sequence:CCGGCGACCGCTTTCTGCTGGTGTTCTCGAGAACACCAGCAGAAAGCGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001736.1-888s1c1
Sequence:CCGGTGCCTACATCAACTGCTGCATCTCGAGATGCAGCAGTTGATGTAGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007577
C5AR1 MISSION shRNA Bacterial Glycerol Stock
complement component 5a receptor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-621s21c1
Sequence:CCGGCGTGTACCGGGAGGCATATAACTCGAGTTATATGCCTCCCGGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007577.3-1442s21c1
Sequence:CCGGGGCTAGGCAGATACACCTAATCTCGAGATTAGGTGTATCTGCCTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-658s21c1
Sequence:CCGGCACACTGTATGTGGTATTAACCTCGAGGTTAATACCACATACAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-398s21c1
Sequence:CCGGATCATAACTACTGGTACTTTGCTCGAGCAAAGTACCAGTAGTTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-155s21c1
Sequence:CCGGGAACCATGGATCCTAACATACCTCGAGGTATGTTAGGATCCATGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-552s1c1
Sequence:CCGGGCACACTGTATGTGGTATTAACTCGAGTTAATACCACATACAGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-648s1c1
Sequence:CCGGGCTCACTCTAAACATCTGCTACTCGAGTAGCAGATGTTTAGAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-58s1c1
Sequence:CCGGGATCCTAACATACCTGCGGATCTCGAGATCCGCAGGTATGTTAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-739s1c1
Sequence:CCGGGCTGTGGTCATCTGTTTCTTTCTCGAGAAAGAAACAGATGACCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-868s1c1
Sequence:CCGGGCCTACATCAACTGCTGTGTTCTCGAGAACACAGCAGTTGATGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007577
C5AR1 MISSION shRNA shRNA Plasmid DNA
complement component 5a receptor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-621s21c1
Sequence:CCGGCGTGTACCGGGAGGCATATAACTCGAGTTATATGCCTCCCGGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007577.3-1442s21c1
Sequence:CCGGGGCTAGGCAGATACACCTAATCTCGAGATTAGGTGTATCTGCCTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-658s21c1
Sequence:CCGGCACACTGTATGTGGTATTAACCTCGAGGTTAATACCACATACAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-398s21c1
Sequence:CCGGATCATAACTACTGGTACTTTGCTCGAGCAAAGTACCAGTAGTTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-155s21c1
Sequence:CCGGGAACCATGGATCCTAACATACCTCGAGGTATGTTAGGATCCATGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-552s1c1
Sequence:CCGGGCACACTGTATGTGGTATTAACTCGAGTTAATACCACATACAGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-648s1c1
Sequence:CCGGGCTCACTCTAAACATCTGCTACTCGAGTAGCAGATGTTTAGAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-58s1c1
Sequence:CCGGGATCCTAACATACCTGCGGATCTCGAGATCCGCAGGTATGTTAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-739s1c1
Sequence:CCGGGCTGTGGTCATCTGTTTCTTTCTCGAGAAAGAAACAGATGACCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-868s1c1
Sequence:CCGGGCCTACATCAACTGCTGTGTTCTCGAGAACACAGCAGTTGATGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007577
C5AR1 MISSION shRNA Lentiviral Transduction Particles
complement component 5a receptor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-621s21c1
Sequence:CCGGCGTGTACCGGGAGGCATATAACTCGAGTTATATGCCTCCCGGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007577.3-1442s21c1
Sequence:CCGGGGCTAGGCAGATACACCTAATCTCGAGATTAGGTGTATCTGCCTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-658s21c1
Sequence:CCGGCACACTGTATGTGGTATTAACCTCGAGGTTAATACCACATACAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-398s21c1
Sequence:CCGGATCATAACTACTGGTACTTTGCTCGAGCAAAGTACCAGTAGTTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007577.3-155s21c1
Sequence:CCGGGAACCATGGATCCTAACATACCTCGAGGTATGTTAGGATCCATGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-552s1c1
Sequence:CCGGGCACACTGTATGTGGTATTAACTCGAGTTAATACCACATACAGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-648s1c1
Sequence:CCGGGCTCACTCTAAACATCTGCTACTCGAGTAGCAGATGTTTAGAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-58s1c1
Sequence:CCGGGATCCTAACATACCTGCGGATCTCGAGATCCGCAGGTATGTTAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-739s1c1
Sequence:CCGGGCTGTGGTCATCTGTTTCTTTCTCGAGAAAGAAACAGATGACCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007577.1-868s1c1
Sequence:CCGGGCCTACATCAACTGCTGTGTTCTCGAGAACACAGCAGTTGATGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)