EMAIL THIS PAGE TO A FRIEND

C5AR2

complement component 5a receptor 2

49 Gene Product Result for
Synonyms: C5L2 GPF77 GPR77
UniProtKB ID: Q9P296, B2RA09
Gene ID:
Human(27202) Summary: This gene encodes a G-protein coupled receptor 1 family member involved in the complement system of the innate immune response. Unlike classical G-protein coupled receptors, the encoded protein does not associate with intracellular G-proteins. It may instead modulate signal transduction through the beta-arrestin pathway, and may alternatively act as a decoy receptor. This gene may be involved in coronary artery disease and in the pathogenesis of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(319430) complement component 5a receptor 2
Rat(445269) complement component 5a receptor 2
domestic guinea pig(100728778) complement component 5a receptor 2
naked mole-rat(101712956) complement component 5a receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018485 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078321 MISSION® esiRNA esiRNA targeting mouse Gpr77 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018485 Rosetta Predictions human pricing
NM_001003710 Rosetta Predictions rat pricing
NM_176912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092777 predicted 405
2 SASI_Hs01_00092778 predicted 664
3 SASI_Hs01_00092779 predicted 318
4 SASI_Hs01_00092780 predicted 396
5 SASI_Hs01_00092781 predicted 411
6 SASI_Hs01_00092782 predicted 368
7 SASI_Hs01_00092783 predicted 404
8 SASI_Hs01_00092784 predicted 573
9 SASI_Hs01_00092785 predicted 222
10 SASI_Hs01_00092786 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077083 predicted 998
2 SASI_Rn01_00077084 predicted 782
3 SASI_Rn01_00077085 predicted 694
4 SASI_Rn01_00077086 predicted 538
5 SASI_Rn01_00077087 predicted 384
6 SASI_Rn02_00198060 predicted 355
7 SASI_Rn01_00077088 predicted 263
8 SASI_Rn01_00077089 predicted 1001
9 SASI_Rn01_00077090 predicted 564
10 SASI_Rn01_00077091 predicted 752
11 SASI_Rn01_00077092 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346784 predicted 1357
2 SASI_Mm02_00346785 predicted 1186
3 SASI_Mm02_00346786 predicted 905
4 SASI_Mm02_00346787 predicted 1372
5 SASI_Mm02_00346788 predicted 1370
6 SASI_Mm02_00346789 predicted 1010
7 SASI_Mm02_00346790 predicted 1588
8 SASI_Mm02_00346791 predicted 1138
9 SASI_Mm02_00346792 predicted 1482
10 SASI_Mm02_00346793 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176912
C5AR2 MISSION shRNA Bacterial Glycerol Stock
complement component 5a receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-500s1c1
Sequence:CCGGCTCCATCACCATTCTGTCTATCTCGAGATAGACAGAATGGTGATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1020s1c1
Sequence:CCGGGCTCTCAATCCCATAATGTTTCTCGAGAAACATTATGGGATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1154s1c1
Sequence:CCGGCCACGAAATGGTGTCTGAGATCTCGAGATCTCAGACACCATTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1125s1c1
Sequence:CCGGGCGGTGACCAAGGTATCCATACTCGAGTATGGATACCTTGGTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-264s1c1
Sequence:CCGGGTCTACCTGATAGTCCTGCTTCTCGAGAAGCAGGACTATCAGGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176912
C5AR2 MISSION shRNA shRNA Plasmid DNA
complement component 5a receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-500s1c1
Sequence:CCGGCTCCATCACCATTCTGTCTATCTCGAGATAGACAGAATGGTGATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1020s1c1
Sequence:CCGGGCTCTCAATCCCATAATGTTTCTCGAGAAACATTATGGGATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1154s1c1
Sequence:CCGGCCACGAAATGGTGTCTGAGATCTCGAGATCTCAGACACCATTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1125s1c1
Sequence:CCGGGCGGTGACCAAGGTATCCATACTCGAGTATGGATACCTTGGTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-264s1c1
Sequence:CCGGGTCTACCTGATAGTCCTGCTTCTCGAGAAGCAGGACTATCAGGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176912
C5AR2 MISSION shRNA Lentiviral Transduction Particles
complement component 5a receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-500s1c1
Sequence:CCGGCTCCATCACCATTCTGTCTATCTCGAGATAGACAGAATGGTGATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1020s1c1
Sequence:CCGGGCTCTCAATCCCATAATGTTTCTCGAGAAACATTATGGGATTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1154s1c1
Sequence:CCGGCCACGAAATGGTGTCTGAGATCTCGAGATCTCAGACACCATTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-1125s1c1
Sequence:CCGGGCGGTGACCAAGGTATCCATACTCGAGTATGGATACCTTGGTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176912.2-264s1c1
Sequence:CCGGGTCTACCTGATAGTCCTGCTTCTCGAGAAGCAGGACTATCAGGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018485
C5AR2 MISSION shRNA Bacterial Glycerol Stock
complement component 5a receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-416s1c1
Sequence:CCGGGCTGACCATGTATGCCAGCGTCTCGAGACGCTGGCATACATGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018485.1-1104s1c1
Sequence:CCGGGTGTGTATCTTCTTATCTCATCTCGAGATGAGATAAGAAGATACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-1026s1c1
Sequence:CCGGGAAAGTGTGGACAGCAAGAAACTCGAGTTTCTTGCTGTCCACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-185s1c1
Sequence:CCGGGCTCCCACTGTATGCCGCCATCTCGAGATGGCGGCATACAGTGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-1023s21c1
Sequence:CCGGGACGAAAGTGTGGACAGCAAGCTCGAGCTTGCTGTCCACACTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-931s21c1
Sequence:CCGGATCCCATGCTCTTCCTGTATTCTCGAGAATACAGGAAGAGCATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018485.1-1106s21c1
Sequence:CCGGGTGTATCTTCTTATCTCATTTCTCGAGAAATGAGATAAGAAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018485
C5AR2 MISSION shRNA shRNA Plasmid DNA
complement component 5a receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-416s1c1
Sequence:CCGGGCTGACCATGTATGCCAGCGTCTCGAGACGCTGGCATACATGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018485.1-1104s1c1
Sequence:CCGGGTGTGTATCTTCTTATCTCATCTCGAGATGAGATAAGAAGATACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-1026s1c1
Sequence:CCGGGAAAGTGTGGACAGCAAGAAACTCGAGTTTCTTGCTGTCCACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-185s1c1
Sequence:CCGGGCTCCCACTGTATGCCGCCATCTCGAGATGGCGGCATACAGTGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-1023s21c1
Sequence:CCGGGACGAAAGTGTGGACAGCAAGCTCGAGCTTGCTGTCCACACTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-931s21c1
Sequence:CCGGATCCCATGCTCTTCCTGTATTCTCGAGAATACAGGAAGAGCATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018485.1-1106s21c1
Sequence:CCGGGTGTATCTTCTTATCTCATTTCTCGAGAAATGAGATAAGAAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018485
C5AR2 MISSION shRNA Lentiviral Transduction Particles
complement component 5a receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-416s1c1
Sequence:CCGGGCTGACCATGTATGCCAGCGTCTCGAGACGCTGGCATACATGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018485.1-1104s1c1
Sequence:CCGGGTGTGTATCTTCTTATCTCATCTCGAGATGAGATAAGAAGATACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-1026s1c1
Sequence:CCGGGAAAGTGTGGACAGCAAGAAACTCGAGTTTCTTGCTGTCCACACTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018485.1-185s1c1
Sequence:CCGGGCTCCCACTGTATGCCGCCATCTCGAGATGGCGGCATACAGTGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-1023s21c1
Sequence:CCGGGACGAAAGTGTGGACAGCAAGCTCGAGCTTGCTGTCCACACTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018485.1-931s21c1
Sequence:CCGGATCCCATGCTCTTCCTGTATTCTCGAGAATACAGGAAGAGCATGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018485.1-1106s21c1
Sequence:CCGGGTGTATCTTCTTATCTCATTTCTCGAGAAATGAGATAAGAAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks