EMAIL THIS PAGE TO A FRIEND

C5orf15

chromosome 5 open reading frame 15

109 Gene Product Result for
Synonyms: KCT2
Species: Human C5orf15(56951)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020199 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107661 MISSION® esiRNA esiRNA human C5orf15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020199 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244995 predicted 1001
2 SASI_Hs01_00244998 predicted 830
3 SASI_Hs01_00245000 predicted 612
4 SASI_Hs01_00245002 predicted 624
5 SASI_Hs02_00353133 predicted 835
6 SASI_Hs02_00353134 predicted 918
7 SASI_Hs01_00244994 predicted 527
8 SASI_Hs02_00353135 predicted 719
9 SASI_Hs02_00353136 predicted 998
10 SASI_Hs01_00244996 predicted 887
11 SASI_Hs01_00244997 predicted 1078
12 SASI_Hs01_00244999 predicted 966
13 SASI_Hs01_00245001 predicted 848
14 SASI_Hs01_00245003 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020199
VALIDATED
C5orf15 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020199.2-555s21c1
Sequence:CCGGACTCTAGACAATGGCGATTATCTCGAGATAATCGCCATTGTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-893s21c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-804s21c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-2132s21c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2208s1c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-966s1c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-1118s1c1
Sequence:CCGGGCCTTGGTGCTTTGGAAATTACTCGAGTAATTTCCAAAGCACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-877s1c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2207s1c1
Sequence:CCGGGCGGACAGTGTACTTTCCTAACTCGAGTTAGGAAAGTACACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020199
VALIDATED
C5orf15 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020199.2-555s21c1
Sequence:CCGGACTCTAGACAATGGCGATTATCTCGAGATAATCGCCATTGTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-893s21c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-804s21c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-2132s21c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2208s1c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-966s1c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-1118s1c1
Sequence:CCGGGCCTTGGTGCTTTGGAAATTACTCGAGTAATTTCCAAAGCACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-877s1c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2207s1c1
Sequence:CCGGGCGGACAGTGTACTTTCCTAACTCGAGTTAGGAAAGTACACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020199
VALIDATED
C5orf15 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020199.2-555s21c1
Sequence:CCGGACTCTAGACAATGGCGATTATCTCGAGATAATCGCCATTGTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-893s21c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-804s21c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020199.2-2132s21c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2208s1c1
Sequence:CCGGCGGACAGTGTACTTTCCTAATCTCGAGATTAGGAAAGTACACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-966s1c1
Sequence:CCGGGCCTTCTTTGAAGATTACCAACTCGAGTTGGTAATCTTCAAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-1118s1c1
Sequence:CCGGGCCTTGGTGCTTTGGAAATTACTCGAGTAATTTCCAAAGCACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020199.1-877s1c1
Sequence:CCGGCTTCTGGTTCAAAGCAGGAAACTCGAGTTTCCTGCTTTGAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020199.1-2207s1c1
Sequence:CCGGGCGGACAGTGTACTTTCCTAACTCGAGTTAGGAAAGTACACTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks