EMAIL THIS PAGE TO A FRIEND

C5orf20

chromosome 5 open reading frame 20

47 Gene Product Result for
Synonyms: DCNP1
Species: Human C5orf20(140947)
Gene ID:
Human(140947) Summary: This intronless gene is specifically expressed in dendritic cells (DCs), which are potent antigen-presenting cells involved in activating naive T cells to initiate antigen-specific immune response. The encoded protein is localized mainly in the perinucleus. One of the alleles (A/T) of this gene, that causes premature translation termination at aa 117, has been associated with an increased prevalence of major depression in humans. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130848 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218191 MISSION® esiRNA esiRNA targeting human C5orf20 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130848 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154501 predicted 667
2 SASI_Hs01_00154502 predicted 244
3 SASI_Hs01_00154503 predicted 615
4 SASI_Hs01_00154504 predicted 641
5 SASI_Hs01_00154506 predicted 618
6 SASI_Hs01_00154507 predicted 621
7 SASI_Hs02_00362891 predicted 630
8 SASI_Hs02_00362892 predicted 832
9 SASI_Hs01_00154508 predicted 252
10 SASI_Hs01_00154509 predicted 679
11 SASI_Hs01_00154505 predicted 293
12 SASI_Hs01_00154510 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130848
C5orf20 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-659s1c1
Sequence:CCGGCGTTCACAGTTCACACAGTCTCTCGAGAGACTGTGTGAACTGTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-373s1c1
Sequence:CCGGCCACCAGAGAACTTTGGGAATCTCGAGATTCCCAAAGTTCTCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130848.1-1161s1c1
Sequence:CCGGCCACAGTTTCTTCTTGTAGAACTCGAGTTCTACAAGAAGAAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-855s1c1
Sequence:CCGGGCACTTGATATCACTATCCCTCTCGAGAGGGATAGTGATATCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-527s1c1
Sequence:CCGGCCAATCTTTCGAGTGAAGCATCTCGAGATGCTTCACTCGAAAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-625s1c1
Sequence:CCGGCGGAAACATCTGGTTTGTAGTCTCGAGACTACAAACCAGATGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-623s1c1
Sequence:CCGGCCCGGAAACATCTGGTTTGTACTCGAGTACAAACCAGATGTTTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-521s1c1
Sequence:CCGGGCAACTCCAATCTTTCGAGTGCTCGAGCACTCGAAAGATTGGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130848.2-1201s21c1
Sequence:CCGGCTTACCTCCTTAGAGTCATTGCTCGAGCAATGACTCTAAGGAGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130848.2-671s21c1
Sequence:CCGGACACAGTCTCACCGGGAAACTCTCGAGAGTTTCCCGGTGAGACTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130848
C5orf20 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-659s1c1
Sequence:CCGGCGTTCACAGTTCACACAGTCTCTCGAGAGACTGTGTGAACTGTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-373s1c1
Sequence:CCGGCCACCAGAGAACTTTGGGAATCTCGAGATTCCCAAAGTTCTCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130848.1-1161s1c1
Sequence:CCGGCCACAGTTTCTTCTTGTAGAACTCGAGTTCTACAAGAAGAAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-855s1c1
Sequence:CCGGGCACTTGATATCACTATCCCTCTCGAGAGGGATAGTGATATCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-527s1c1
Sequence:CCGGCCAATCTTTCGAGTGAAGCATCTCGAGATGCTTCACTCGAAAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-625s1c1
Sequence:CCGGCGGAAACATCTGGTTTGTAGTCTCGAGACTACAAACCAGATGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-623s1c1
Sequence:CCGGCCCGGAAACATCTGGTTTGTACTCGAGTACAAACCAGATGTTTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-521s1c1
Sequence:CCGGGCAACTCCAATCTTTCGAGTGCTCGAGCACTCGAAAGATTGGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130848.2-1201s21c1
Sequence:CCGGCTTACCTCCTTAGAGTCATTGCTCGAGCAATGACTCTAAGGAGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130848.2-671s21c1
Sequence:CCGGACACAGTCTCACCGGGAAACTCTCGAGAGTTTCCCGGTGAGACTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130848
C5orf20 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-659s1c1
Sequence:CCGGCGTTCACAGTTCACACAGTCTCTCGAGAGACTGTGTGAACTGTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-373s1c1
Sequence:CCGGCCACCAGAGAACTTTGGGAATCTCGAGATTCCCAAAGTTCTCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130848.1-1161s1c1
Sequence:CCGGCCACAGTTTCTTCTTGTAGAACTCGAGTTCTACAAGAAGAAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-855s1c1
Sequence:CCGGGCACTTGATATCACTATCCCTCTCGAGAGGGATAGTGATATCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-527s1c1
Sequence:CCGGCCAATCTTTCGAGTGAAGCATCTCGAGATGCTTCACTCGAAAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-625s1c1
Sequence:CCGGCGGAAACATCTGGTTTGTAGTCTCGAGACTACAAACCAGATGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130848.1-623s1c1
Sequence:CCGGCCCGGAAACATCTGGTTTGTACTCGAGTACAAACCAGATGTTTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130848.1-521s1c1
Sequence:CCGGGCAACTCCAATCTTTCGAGTGCTCGAGCACTCGAAAGATTGGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130848.2-1201s21c1
Sequence:CCGGCTTACCTCCTTAGAGTCATTGCTCGAGCAATGACTCTAAGGAGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130848.2-671s21c1
Sequence:CCGGACACAGTCTCACCGGGAAACTCTCGAGAGTTTCCCGGTGAGACTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)