EMAIL THIS PAGE TO A FRIEND

C5orf22

chromosome 5 open reading frame 22

UniProtKB ID: Q49AR2, Q8ND28, Q8WU61, Q9NUR1
Gene ID:
chicken(420910) chromosome 2 open reading frame, human C5orf22
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086251 MISSION® esiRNA esiRNA human C5orf22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039412 predicted 570
2 SASI_Hs01_00039413 predicted 1168
3 SASI_Hs01_00039415 predicted 300
4 SASI_Hs01_00039417 predicted 1152
5 SASI_Hs01_00039418 predicted 1309
6 SASI_Hs01_00039419 predicted 1099
7 SASI_Hs01_00039420 predicted 501
8 SASI_Hs02_00351815 predicted 385
9 SASI_Hs02_00351816 predicted 213
10 SASI_Hs02_00351817 predicted 661
11 SASI_Hs01_00039411 predicted 522
12 SASI_Hs01_00039414 predicted 535
13 SASI_Hs01_00039416 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018356
VALIDATED
C5orf22 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1183s1c1
Sequence:CCGGGCTGGTTTAACCTGCGATTATCTCGAGATAATCGCAGGTTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1147s1c1
Sequence:CCGGCGGATGGAAGTACCAGACTATCTCGAGATAGTCTGGTACTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1102s1c1
Sequence:CCGGCCTGGAATGGAATCACTAGTTCTCGAGAACTAGTGATTCCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-476s1c1
Sequence:CCGGCTACCACAACAATCAGGGTTACTCGAGTAACCCTGATTGTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-971s1c1
Sequence:CCGGCCAACCTAACAGAGGAAGATTCTCGAGAATCTTCCTCTGTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-464s1c1
Sequence:CCGGGCAAAGACACTTCTACCACAACTCGAGTTGTGGTAGAAGTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018356.1-758s1c1
Sequence:CCGGGCCTAGAACCATCATGTTCATCTCGAGATGAACATGATGGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1319s1c1
Sequence:CCGGGTCTGGATGATTACTGTCCTTCTCGAGAAGGACAGTAATCATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1342s1c1
Sequence:CCGGGACCAAGTTGACACTATTCAACTCGAGTTGAATAGTGTCAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-2141s1c1
Sequence:CCGGGCCAGAAACTAACATTCTCAACTCGAGTTGAGAATGTTAGTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-898s1c1
Sequence:CCGGCCCTTCAAAGAAATGTTCACTCTCGAGAGTGAACATTTCTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018356
VALIDATED
C5orf22 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1183s1c1
Sequence:CCGGGCTGGTTTAACCTGCGATTATCTCGAGATAATCGCAGGTTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1147s1c1
Sequence:CCGGCGGATGGAAGTACCAGACTATCTCGAGATAGTCTGGTACTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1102s1c1
Sequence:CCGGCCTGGAATGGAATCACTAGTTCTCGAGAACTAGTGATTCCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-476s1c1
Sequence:CCGGCTACCACAACAATCAGGGTTACTCGAGTAACCCTGATTGTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-971s1c1
Sequence:CCGGCCAACCTAACAGAGGAAGATTCTCGAGAATCTTCCTCTGTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-464s1c1
Sequence:CCGGGCAAAGACACTTCTACCACAACTCGAGTTGTGGTAGAAGTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018356.1-758s1c1
Sequence:CCGGGCCTAGAACCATCATGTTCATCTCGAGATGAACATGATGGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1319s1c1
Sequence:CCGGGTCTGGATGATTACTGTCCTTCTCGAGAAGGACAGTAATCATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1342s1c1
Sequence:CCGGGACCAAGTTGACACTATTCAACTCGAGTTGAATAGTGTCAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-2141s1c1
Sequence:CCGGGCCAGAAACTAACATTCTCAACTCGAGTTGAGAATGTTAGTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-898s1c1
Sequence:CCGGCCCTTCAAAGAAATGTTCACTCTCGAGAGTGAACATTTCTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018356
VALIDATED
C5orf22 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1183s1c1
Sequence:CCGGGCTGGTTTAACCTGCGATTATCTCGAGATAATCGCAGGTTAAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1147s1c1
Sequence:CCGGCGGATGGAAGTACCAGACTATCTCGAGATAGTCTGGTACTTCCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1102s1c1
Sequence:CCGGCCTGGAATGGAATCACTAGTTCTCGAGAACTAGTGATTCCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-476s1c1
Sequence:CCGGCTACCACAACAATCAGGGTTACTCGAGTAACCCTGATTGTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-971s1c1
Sequence:CCGGCCAACCTAACAGAGGAAGATTCTCGAGAATCTTCCTCTGTTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-464s1c1
Sequence:CCGGGCAAAGACACTTCTACCACAACTCGAGTTGTGGTAGAAGTGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018356.1-758s1c1
Sequence:CCGGGCCTAGAACCATCATGTTCATCTCGAGATGAACATGATGGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-1319s1c1
Sequence:CCGGGTCTGGATGATTACTGTCCTTCTCGAGAAGGACAGTAATCATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-1342s1c1
Sequence:CCGGGACCAAGTTGACACTATTCAACTCGAGTTGAATAGTGTCAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018356.1-2141s1c1
Sequence:CCGGGCCAGAAACTAACATTCTCAACTCGAGTTGAGAATGTTAGTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018356.1-898s1c1
Sequence:CCGGCCCTTCAAAGAAATGTTCACTCTCGAGAGTGAACATTTCTTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks