EMAIL THIS PAGE TO A FRIEND

C5orf24

chromosome 5 open reading frame 24

183 Gene Product Result for
Species: Human C5orf24(134553)
UniProtKB ID: Q7Z6I8, D3DQA7, Q86Y53, Q8N1T9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152409 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131301 MISSION® esiRNA esiRNA human C5orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152409 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058451 predicted 650
2 SASI_Hs01_00058452 predicted 395
3 SASI_Hs02_00366099 predicted 915
4 SASI_Hs01_00058454 predicted 868
5 SASI_Hs01_00058455 predicted 607
6 SASI_Hs01_00058456 predicted 435
7 SASI_Hs02_00366100 predicted 234
8 SASI_Hs01_00058457 predicted 304
9 SASI_Hs01_00058458 predicted 879
10 SASI_Hs01_00058460 predicted 819
11 SASI_Hs01_00058453 predicted 838
12 SASI_Hs01_00058459 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152409
VALIDATED
C5orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 24
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-3448s1c1
Sequence:CCGGGCTGAAGAGAAAGACATCTAACTCGAGTTAGATGTCTTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-486s1c1
Sequence:CCGGCAGGTAGCATTAAAGCTCTATCTCGAGATAGAGCTTTAATGCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152409.2-2958s1c1
Sequence:CCGGCCATAGAATAATGCACACCATCTCGAGATGGTGTGCATTATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-146s1c1
Sequence:CCGGGCTGATCAGTTTGACATATATCTCGAGATATATGTCAAACTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-919s1c1
Sequence:CCGGGCTGTTCTAAATAGATGCTTTCTCGAGAAAGCATCTATTTAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-587s1c1
Sequence:CCGGGTAGAGGAAACTAGCAGTGAACTCGAGTTCACTGCTAGTTTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-2564s1c1
Sequence:CCGGGCTGGACTTTATGCTGCTCTTCTCGAGAAGAGCAGCATAAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-509s1c1
Sequence:CCGGCGTCTTGCCGATCTTGGTTATCTCGAGATAACCAAGATCGGCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-256s1c1
Sequence:CCGGGACTACAAGTGGCAGAAGCATCTCGAGATGCTTCTGCCACTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-219s1c1
Sequence:CCGGGTCAGAGGCAAGACCCATTAACTCGAGTTAATGGGTCTTGCCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-307s1c1
Sequence:CCGGGAATCTCAACCGATCTGGTAACTCGAGTTACCAGATCGGTTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-485s1c1
Sequence:CCGGCCAGGTAGCATTAAAGCTCTACTCGAGTAGAGCTTTAATGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-958s21c1
Sequence:CCGGACCATTATACCTATTAGTTTGCTCGAGCAAACTAATAGGTATAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152409.3-447s21c1
Sequence:CCGGCTAAAGCTGCGGGATACAAAGCTCGAGCTTTGTATCCCGCAGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-896s21c1
Sequence:CCGGTCATGTTTCATTACTACTTTGCTCGAGCAAAGTAGTAATGAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152409
VALIDATED
C5orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 24
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-3448s1c1
Sequence:CCGGGCTGAAGAGAAAGACATCTAACTCGAGTTAGATGTCTTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-486s1c1
Sequence:CCGGCAGGTAGCATTAAAGCTCTATCTCGAGATAGAGCTTTAATGCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152409.2-2958s1c1
Sequence:CCGGCCATAGAATAATGCACACCATCTCGAGATGGTGTGCATTATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-146s1c1
Sequence:CCGGGCTGATCAGTTTGACATATATCTCGAGATATATGTCAAACTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-919s1c1
Sequence:CCGGGCTGTTCTAAATAGATGCTTTCTCGAGAAAGCATCTATTTAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-587s1c1
Sequence:CCGGGTAGAGGAAACTAGCAGTGAACTCGAGTTCACTGCTAGTTTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-2564s1c1
Sequence:CCGGGCTGGACTTTATGCTGCTCTTCTCGAGAAGAGCAGCATAAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-509s1c1
Sequence:CCGGCGTCTTGCCGATCTTGGTTATCTCGAGATAACCAAGATCGGCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-256s1c1
Sequence:CCGGGACTACAAGTGGCAGAAGCATCTCGAGATGCTTCTGCCACTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-219s1c1
Sequence:CCGGGTCAGAGGCAAGACCCATTAACTCGAGTTAATGGGTCTTGCCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-307s1c1
Sequence:CCGGGAATCTCAACCGATCTGGTAACTCGAGTTACCAGATCGGTTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-485s1c1
Sequence:CCGGCCAGGTAGCATTAAAGCTCTACTCGAGTAGAGCTTTAATGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-958s21c1
Sequence:CCGGACCATTATACCTATTAGTTTGCTCGAGCAAACTAATAGGTATAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152409.3-447s21c1
Sequence:CCGGCTAAAGCTGCGGGATACAAAGCTCGAGCTTTGTATCCCGCAGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-896s21c1
Sequence:CCGGTCATGTTTCATTACTACTTTGCTCGAGCAAAGTAGTAATGAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152409
VALIDATED
C5orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 24
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-3448s1c1
Sequence:CCGGGCTGAAGAGAAAGACATCTAACTCGAGTTAGATGTCTTTCTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-486s1c1
Sequence:CCGGCAGGTAGCATTAAAGCTCTATCTCGAGATAGAGCTTTAATGCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152409.2-2958s1c1
Sequence:CCGGCCATAGAATAATGCACACCATCTCGAGATGGTGTGCATTATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-146s1c1
Sequence:CCGGGCTGATCAGTTTGACATATATCTCGAGATATATGTCAAACTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-919s1c1
Sequence:CCGGGCTGTTCTAAATAGATGCTTTCTCGAGAAAGCATCTATTTAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152409.2-587s1c1
Sequence:CCGGGTAGAGGAAACTAGCAGTGAACTCGAGTTCACTGCTAGTTTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152409.2-2564s1c1
Sequence:CCGGGCTGGACTTTATGCTGCTCTTCTCGAGAAGAGCAGCATAAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-509s1c1
Sequence:CCGGCGTCTTGCCGATCTTGGTTATCTCGAGATAACCAAGATCGGCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152409.2-256s1c1
Sequence:CCGGGACTACAAGTGGCAGAAGCATCTCGAGATGCTTCTGCCACTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-219s1c1
Sequence:CCGGGTCAGAGGCAAGACCCATTAACTCGAGTTAATGGGTCTTGCCTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152409.2-307s1c1
Sequence:CCGGGAATCTCAACCGATCTGGTAACTCGAGTTACCAGATCGGTTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152409.2-485s1c1
Sequence:CCGGCCAGGTAGCATTAAAGCTCTACTCGAGTAGAGCTTTAATGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-958s21c1
Sequence:CCGGACCATTATACCTATTAGTTTGCTCGAGCAAACTAATAGGTATAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152409.3-447s21c1
Sequence:CCGGCTAAAGCTGCGGGATACAAAGCTCGAGCTTTGTATCCCGCAGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152409.3-896s21c1
Sequence:CCGGTCATGTTTCATTACTACTTTGCTCGAGCAAAGTAGTAATGAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks