EMAIL THIS PAGE TO A FRIEND

C5orf27

chromosome 5 open reading frame 27

73 Gene Product Result for
Synonyms: FIS
Species: Human C5orf27(202299)
UniProtKB ID: Q52M75, B2RBN1, Q86YS4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175616 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228351 MISSION® esiRNA esiRNA targeting human C5orf27 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175616 Rosetta Predictions human pricing
XR_040298 Rosetta Predictions human pricing
XR_040299 Rosetta Predictions human pricing
XR_040300 Rosetta Predictions human pricing
XR_040301 Rosetta Predictions human pricing
XR_040302 Rosetta Predictions human pricing
XR_040303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246367 predicted 772
2 SASI_Hs01_00246368 predicted 841
3 SASI_Hs01_00246369 predicted 889
4 SASI_Hs01_00246370 predicted 952
5 SASI_Hs01_00246371 predicted 1039
6 SASI_Hs01_00246372 predicted 1054
7 SASI_Hs01_00246373 predicted 962
8 SASI_Hs01_00246374 predicted 782
9 SASI_Hs01_00246375 predicted 872
10 SASI_Hs01_00246376 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517624 predicted 784
2 SASI_Hs02_00517625 predicted 1538
3 SASI_Hs02_00517626 predicted 849
4 SASI_Hs02_00517627 predicted 971
5 SASI_Hs02_00517628 predicted 1047
6 SASI_Hs02_00517629 predicted 1031
7 SASI_Hs02_00517630 predicted 1064
8 SASI_Hs02_00517631 predicted 833
9 SASI_Hs02_00517632 predicted 788
10 SASI_Hs02_00517633 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517634 predicted 742
2 SASI_Hs02_00517635 predicted 1491
3 SASI_Hs02_00517636 predicted 805
4 SASI_Hs02_00517637 predicted 1006
5 SASI_Hs02_00517638 predicted 1019
6 SASI_Hs02_00517639 predicted 781
7 SASI_Hs02_00517640 predicted 745
8 SASI_Hs02_00517641 predicted 844
9 SASI_Hs02_00517642 predicted 645
10 SASI_Hs02_00517643 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517644 predicted 788
2 SASI_Hs02_00517645 predicted 1536
3 SASI_Hs02_00517646 predicted 856
4 SASI_Hs02_00517647 predicted 963
5 SASI_Hs02_00517648 predicted 1053
6 SASI_Hs02_00517649 predicted 1030
7 SASI_Hs02_00517650 predicted 1061
8 SASI_Hs02_00517651 predicted 829
9 SASI_Hs02_00517652 predicted 795
10 SASI_Hs02_00517653 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517654 predicted 737
2 SASI_Hs02_00517655 predicted 1495
3 SASI_Hs02_00517656 predicted 804
4 SASI_Hs02_00517657 predicted 1004
5 SASI_Hs02_00517658 predicted 1015
6 SASI_Hs02_00517659 predicted 790
7 SASI_Hs02_00517660 predicted 746
8 SASI_Hs02_00517661 predicted 841
9 SASI_Hs02_00517662 predicted 644
10 SASI_Hs02_00517663 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517664 predicted 784
2 SASI_Hs02_00517665 predicted 1535
3 SASI_Hs02_00517666 predicted 855
4 SASI_Hs02_00517667 predicted 969
5 SASI_Hs02_00517668 predicted 1053
6 SASI_Hs02_00517669 predicted 1030
7 SASI_Hs02_00517670 predicted 1062
8 SASI_Hs02_00517671 predicted 826
9 SASI_Hs02_00517672 predicted 787
10 SASI_Hs02_00517673 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517674 predicted 739
2 SASI_Hs02_00517675 predicted 1490
3 SASI_Hs02_00517676 predicted 811
4 SASI_Hs02_00517677 predicted 1001
5 SASI_Hs02_00517678 predicted 1016
6 SASI_Hs02_00517679 predicted 782
7 SASI_Hs02_00517680 predicted 742
8 SASI_Hs02_00517681 predicted 844
9 SASI_Hs02_00517682 predicted 641
10 SASI_Hs02_00517683 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175616
C5orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-484s1c1
Sequence:CCGGCTGAAAGCAAACCTCAAGGACCTCGAGGTCCTTGAGGTTTGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-455s1c1
Sequence:CCGGGCCATTTCTCATTCAGGACTGCTCGAGCAGTCCTGAATGAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-491s1c1
Sequence:CCGGCAAACCTCAAGGACAGGACTTCTCGAGAAGTCCTGTCCTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-432s1c1
Sequence:CCGGGACTGCAAGCAGAATATCCCTCTCGAGAGGGATATTCTGCTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-440s1c1
Sequence:CCGGGCAGAATATCCCTTTGCCATTCTCGAGAATGGCAAAGGGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-1436s1c1
Sequence:CCGGCCTGGGTTTACATCAAGAGAACTCGAGTTCTCTTGATGTAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-816s1c1
Sequence:CCGGGCAGAATGAGTTCATGTGAAACTCGAGTTTCACATGAACTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-441s1c1
Sequence:CCGGCAGAATATCCCTTTGCCATTTCTCGAGAAATGGCAAAGGGATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-848s1c1
Sequence:CCGGGCCATGACTCAGATTCACTTTCTCGAGAAAGTGAATCTGAGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-434s1c1
Sequence:CCGGCTGCAAGCAGAATATCCCTTTCTCGAGAAAGGGATATTCTGCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175616
C5orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-484s1c1
Sequence:CCGGCTGAAAGCAAACCTCAAGGACCTCGAGGTCCTTGAGGTTTGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-455s1c1
Sequence:CCGGGCCATTTCTCATTCAGGACTGCTCGAGCAGTCCTGAATGAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-491s1c1
Sequence:CCGGCAAACCTCAAGGACAGGACTTCTCGAGAAGTCCTGTCCTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-432s1c1
Sequence:CCGGGACTGCAAGCAGAATATCCCTCTCGAGAGGGATATTCTGCTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-440s1c1
Sequence:CCGGGCAGAATATCCCTTTGCCATTCTCGAGAATGGCAAAGGGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-1436s1c1
Sequence:CCGGCCTGGGTTTACATCAAGAGAACTCGAGTTCTCTTGATGTAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-816s1c1
Sequence:CCGGGCAGAATGAGTTCATGTGAAACTCGAGTTTCACATGAACTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-441s1c1
Sequence:CCGGCAGAATATCCCTTTGCCATTTCTCGAGAAATGGCAAAGGGATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-848s1c1
Sequence:CCGGGCCATGACTCAGATTCACTTTCTCGAGAAAGTGAATCTGAGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-434s1c1
Sequence:CCGGCTGCAAGCAGAATATCCCTTTCTCGAGAAAGGGATATTCTGCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175616
C5orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-484s1c1
Sequence:CCGGCTGAAAGCAAACCTCAAGGACCTCGAGGTCCTTGAGGTTTGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-455s1c1
Sequence:CCGGGCCATTTCTCATTCAGGACTGCTCGAGCAGTCCTGAATGAGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-491s1c1
Sequence:CCGGCAAACCTCAAGGACAGGACTTCTCGAGAAGTCCTGTCCTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-432s1c1
Sequence:CCGGGACTGCAAGCAGAATATCCCTCTCGAGAGGGATATTCTGCTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-440s1c1
Sequence:CCGGGCAGAATATCCCTTTGCCATTCTCGAGAATGGCAAAGGGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-1436s1c1
Sequence:CCGGCCTGGGTTTACATCAAGAGAACTCGAGTTCTCTTGATGTAAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-816s1c1
Sequence:CCGGGCAGAATGAGTTCATGTGAAACTCGAGTTTCACATGAACTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-441s1c1
Sequence:CCGGCAGAATATCCCTTTGCCATTTCTCGAGAAATGGCAAAGGGATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175616.2-848s1c1
Sequence:CCGGGCCATGACTCAGATTCACTTTCTCGAGAAAGTGAATCTGAGTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175616.2-434s1c1
Sequence:CCGGCTGCAAGCAGAATATCCCTTTCTCGAGAAAGGGATATTCTGCTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks