EMAIL THIS PAGE TO A FRIEND

C5orf28

chromosome 5 open reading frame 28

65 Gene Product Result for
Species: Human C5orf28(64417)
UniProtKB ID: Q0VDI3, B2RDA6, Q9H6Z2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059946 Anti-C5orf28 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022483 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012461 MISSION® esiRNA esiRNA targeting human C5orf28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102777 predicted 882
2 SASI_Hs02_00355766 predicted 896
3 SASI_Hs01_00102780 predicted 765
4 SASI_Hs01_00102781 predicted 857
5 SASI_Hs01_00102782 predicted 951
6 SASI_Hs01_00102783 predicted 724
7 SASI_Hs01_00102784 predicted 666
8 SASI_Hs01_00102785 predicted 688
9 SASI_Hs01_00102786 predicted 633
10 SASI_Hs02_00355767 predicted 980
11 SASI_Hs01_00102778 predicted 819
12 SASI_Hs01_00102779 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022483
VALIDATED
C5orf28 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 28
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022483.3-1092s1c1
Sequence:CCGGCCTCTTGCTCAGGAAGTGTATCTCGAGATACACTTCCTGAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-973s1c1
Sequence:CCGGCGGCAGTCTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAAGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-743s1c1
Sequence:CCGGGCTTTCTTCCCTGGATGTTATCTCGAGATAACATCCAGGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-920s1c1
Sequence:CCGGCCAGACAAATGATGTCTTCAACTCGAGTTGAAGACATCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-537s1c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022483.3-798s1c1
Sequence:CCGGGATTCGTCATGGTTTGTGGATCTCGAGATCCACAAACCATGACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-459s1c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-515s1c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-362s21c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-284s21c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-340s21c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-710s21c1
Sequence:CCGGTCACATCTGTTCATTCGTTATCTCGAGATAACGAATGAACAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022483
VALIDATED
C5orf28 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 28
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022483.3-1092s1c1
Sequence:CCGGCCTCTTGCTCAGGAAGTGTATCTCGAGATACACTTCCTGAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-973s1c1
Sequence:CCGGCGGCAGTCTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAAGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-743s1c1
Sequence:CCGGGCTTTCTTCCCTGGATGTTATCTCGAGATAACATCCAGGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-920s1c1
Sequence:CCGGCCAGACAAATGATGTCTTCAACTCGAGTTGAAGACATCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-537s1c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022483.3-798s1c1
Sequence:CCGGGATTCGTCATGGTTTGTGGATCTCGAGATCCACAAACCATGACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-459s1c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-515s1c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-362s21c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-284s21c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-340s21c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-710s21c1
Sequence:CCGGTCACATCTGTTCATTCGTTATCTCGAGATAACGAATGAACAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022483
VALIDATED
C5orf28 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 28
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022483.3-1092s1c1
Sequence:CCGGCCTCTTGCTCAGGAAGTGTATCTCGAGATACACTTCCTGAGCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-973s1c1
Sequence:CCGGCGGCAGTCTTAGAGAAGCAAACTCGAGTTTGCTTCTCTAAGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-743s1c1
Sequence:CCGGGCTTTCTTCCCTGGATGTTATCTCGAGATAACATCCAGGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022483.3-920s1c1
Sequence:CCGGCCAGACAAATGATGTCTTCAACTCGAGTTGAAGACATCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-537s1c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022483.3-798s1c1
Sequence:CCGGGATTCGTCATGGTTTGTGGATCTCGAGATCCACAAACCATGACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-459s1c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_022483.3-515s1c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-362s21c1
Sequence:CCGGGAAGACTGACTTTGGAGAAATCTCGAGATTTCTCCAAAGTCAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-284s21c1
Sequence:CCGGGCTTCGTGCTCTCTCAGATAACTCGAGTTATCTGAGAGAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022483.4-340s21c1
Sequence:CCGGCGGTAGTCACTGGAATCAAGACTCGAGTCTTGATTCCAGTGACTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022483.4-710s21c1
Sequence:CCGGTCACATCTGTTCATTCGTTATCTCGAGATAACGAATGAACAGATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks