EMAIL THIS PAGE TO A FRIEND

C5orf30

chromosome 5 open reading frame 30

124 Gene Product Result for
UniProtKB ID: Q96GV9
Gene ID:
chicken(768501) chromosome Z open reading frame, human C5orf30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033211 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056961 MISSION® esiRNA esiRNA human C5orf30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033211 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016586 predicted 675
2 SASI_Hs01_00016587 predicted 416
3 SASI_Hs01_00016588 predicted 660
4 SASI_Hs01_00016589 predicted 407
5 SASI_Hs01_00016590 predicted 794
6 SASI_Hs01_00016591 predicted 803
7 SASI_Hs01_00016592 predicted 759
8 SASI_Hs01_00016593 predicted 763
9 SASI_Hs01_00016594 predicted 594
10 SASI_Hs01_00016595 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033211
VALIDATED
C5orf30 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-672s21c1
Sequence:CCGGGACAAGTGCACTAAATCTTTACTCGAGTAAAGATTTAGTGCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-773s21c1
Sequence:CCGGGGACTACCTCAATCTAGATAACTCGAGTTATCTAGATTGAGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-430s21c1
Sequence:CCGGTACACATGGACTCTAACTATTCTCGAGAATAGTTAGAGTCCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-469s21c1
Sequence:CCGGGCGAGGAACTCCTGAAGTTAGCTCGAGCTAACTTCAGGAGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-877s21c1
Sequence:CCGGGGAATAATACATGAATGACTTCTCGAGAAGTCATTCATGTATTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-493s21c1
Sequence:CCGGAGAAGTGCACAGGAGGTGAAGCTCGAGCTTCACCTCCTGTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1547s1c1
Sequence:CCGGGCGTTATTAAAGTGTGTCTTACTCGAGTAAGACACACTTTAATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1227s1c1
Sequence:CCGGGCTGACTTGATATGATTCATTCTCGAGAATGAATCATATCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-730s1c1
Sequence:CCGGCTCTTTGTCTTCTTAAAGGTACTCGAGTACCTTTAAGAAGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-828s1c1
Sequence:CCGGCAGTACCAGCTTCAACACCTACTCGAGTAGGTGTTGAAGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033211
VALIDATED
C5orf30 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-672s21c1
Sequence:CCGGGACAAGTGCACTAAATCTTTACTCGAGTAAAGATTTAGTGCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-773s21c1
Sequence:CCGGGGACTACCTCAATCTAGATAACTCGAGTTATCTAGATTGAGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-430s21c1
Sequence:CCGGTACACATGGACTCTAACTATTCTCGAGAATAGTTAGAGTCCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-469s21c1
Sequence:CCGGGCGAGGAACTCCTGAAGTTAGCTCGAGCTAACTTCAGGAGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-877s21c1
Sequence:CCGGGGAATAATACATGAATGACTTCTCGAGAAGTCATTCATGTATTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-493s21c1
Sequence:CCGGAGAAGTGCACAGGAGGTGAAGCTCGAGCTTCACCTCCTGTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1547s1c1
Sequence:CCGGGCGTTATTAAAGTGTGTCTTACTCGAGTAAGACACACTTTAATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1227s1c1
Sequence:CCGGGCTGACTTGATATGATTCATTCTCGAGAATGAATCATATCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-730s1c1
Sequence:CCGGCTCTTTGTCTTCTTAAAGGTACTCGAGTACCTTTAAGAAGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-828s1c1
Sequence:CCGGCAGTACCAGCTTCAACACCTACTCGAGTAGGTGTTGAAGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033211
VALIDATED
C5orf30 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-672s21c1
Sequence:CCGGGACAAGTGCACTAAATCTTTACTCGAGTAAAGATTTAGTGCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-773s21c1
Sequence:CCGGGGACTACCTCAATCTAGATAACTCGAGTTATCTAGATTGAGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-430s21c1
Sequence:CCGGTACACATGGACTCTAACTATTCTCGAGAATAGTTAGAGTCCATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-469s21c1
Sequence:CCGGGCGAGGAACTCCTGAAGTTAGCTCGAGCTAACTTCAGGAGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-877s21c1
Sequence:CCGGGGAATAATACATGAATGACTTCTCGAGAAGTCATTCATGTATTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033211.2-493s21c1
Sequence:CCGGAGAAGTGCACAGGAGGTGAAGCTCGAGCTTCACCTCCTGTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1547s1c1
Sequence:CCGGGCGTTATTAAAGTGTGTCTTACTCGAGTAAGACACACTTTAATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-1227s1c1
Sequence:CCGGGCTGACTTGATATGATTCATTCTCGAGAATGAATCATATCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-730s1c1
Sequence:CCGGCTCTTTGTCTTCTTAAAGGTACTCGAGTACCTTTAAGAAGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033211.2-828s1c1
Sequence:CCGGCAGTACCAGCTTCAACACCTACTCGAGTAGGTGTTGAAGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks