EMAIL THIS PAGE TO A FRIEND

C5orf34

chromosome 5 open reading frame 34

29 Gene Product Result for
Species: Human C5orf34(375444)
UniProtKB ID: Q96MH7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198566 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012481 MISSION® esiRNA esiRNA targeting human C5orf34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198566 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112134 predicted 1878
2 SASI_Hs01_00112135 predicted 730
3 SASI_Hs01_00112137 predicted 2122
4 SASI_Hs01_00112139 predicted 1809
5 SASI_Hs01_00112140 predicted 1844
6 SASI_Hs01_00112141 predicted 680
7 SASI_Hs01_00112142 predicted 505
8 SASI_Hs01_00112143 predicted 2116
9 SASI_Hs02_00372192 predicted 1325
10 SASI_Hs02_00372193 predicted 1778
11 SASI_Hs01_00112136 predicted 1799
12 SASI_Hs01_00112138 predicted 1285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198566
VALIDATED
C5orf34 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 34
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-573s1c1
Sequence:CCGGGAAACCATCATACCTTCTGAACTCGAGTTCAGAAGGTATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-694s1c1
Sequence:CCGGCATCTTTAGATGGTCATGCATCTCGAGATGCATGACCATCTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-1134s1c1
Sequence:CCGGGCACATATAACTCAGAGTAGACTCGAGTCTACTCTGAGTTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198566.1-1710s1c1
Sequence:CCGGGCCTACTCTGATGACAAAGTACTCGAGTACTTTGTCATCAGAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1848s1c1
Sequence:CCGGGATGGACAAGAGCAGTTAATTCTCGAGAATTAACTGCTCTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198566.1-2196s1c1
Sequence:CCGGCACGATATTGACTGTCTTCTACTCGAGTAGAAGACAGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1635s1c1
Sequence:CCGGCCTGGGATAAATGATAGCAATCTCGAGATTGCTATCATTTATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-453s1c1
Sequence:CCGGCCTTTAGAACAACCAGAAAGACTCGAGTCTTTCTGGTTGTTCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198566.1-2275s1c1
Sequence:CCGGGTTGTTTCAAGTGACTGGTATCTCGAGATACCAGTCACTTGAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-637s1c1
Sequence:CCGGCCAGTCTTGATACAGATGGTACTCGAGTACCATCTGTATCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1949s21c1
Sequence:CCGGCAGAGAGATGCCCACTCATTCCTCGAGGAATGAGTGGGCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-946s21c1
Sequence:CCGGAGAAGATGAGTTGTGTAAATGCTCGAGCATTTACACAACTCATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1872s21c1
Sequence:CCGGATTGAACACCCTGAACCATATCTCGAGATATGGTTCAGGGTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1079s21c1
Sequence:CCGGTTTGTCTTTAGCACTTCATTTCTCGAGAAATGAAGTGCTAAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-353s21c1
Sequence:CCGGTGATTCAGTACAAGTACAATACTCGAGTATTGTACTTGTACTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2029s21c1
Sequence:CCGGAGTTTAACTTGCTACTAGAAACTCGAGTTTCTAGTAGCAAGTTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2054s21c1
Sequence:CCGGTGGTATCCTAAACCAGATTTCCTCGAGGAAATCTGGTTTAGGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1749s21c1
Sequence:CCGGGGCATTACTCTAACCCTAAATCTCGAGATTTAGGGTTAGAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198566
VALIDATED
C5orf34 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 34
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-573s1c1
Sequence:CCGGGAAACCATCATACCTTCTGAACTCGAGTTCAGAAGGTATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-694s1c1
Sequence:CCGGCATCTTTAGATGGTCATGCATCTCGAGATGCATGACCATCTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-1134s1c1
Sequence:CCGGGCACATATAACTCAGAGTAGACTCGAGTCTACTCTGAGTTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198566.1-1710s1c1
Sequence:CCGGGCCTACTCTGATGACAAAGTACTCGAGTACTTTGTCATCAGAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1848s1c1
Sequence:CCGGGATGGACAAGAGCAGTTAATTCTCGAGAATTAACTGCTCTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198566.1-2196s1c1
Sequence:CCGGCACGATATTGACTGTCTTCTACTCGAGTAGAAGACAGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1635s1c1
Sequence:CCGGCCTGGGATAAATGATAGCAATCTCGAGATTGCTATCATTTATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-453s1c1
Sequence:CCGGCCTTTAGAACAACCAGAAAGACTCGAGTCTTTCTGGTTGTTCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198566.1-2275s1c1
Sequence:CCGGGTTGTTTCAAGTGACTGGTATCTCGAGATACCAGTCACTTGAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-637s1c1
Sequence:CCGGCCAGTCTTGATACAGATGGTACTCGAGTACCATCTGTATCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1949s21c1
Sequence:CCGGCAGAGAGATGCCCACTCATTCCTCGAGGAATGAGTGGGCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-946s21c1
Sequence:CCGGAGAAGATGAGTTGTGTAAATGCTCGAGCATTTACACAACTCATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1872s21c1
Sequence:CCGGATTGAACACCCTGAACCATATCTCGAGATATGGTTCAGGGTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1079s21c1
Sequence:CCGGTTTGTCTTTAGCACTTCATTTCTCGAGAAATGAAGTGCTAAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-353s21c1
Sequence:CCGGTGATTCAGTACAAGTACAATACTCGAGTATTGTACTTGTACTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2029s21c1
Sequence:CCGGAGTTTAACTTGCTACTAGAAACTCGAGTTTCTAGTAGCAAGTTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2054s21c1
Sequence:CCGGTGGTATCCTAAACCAGATTTCCTCGAGGAAATCTGGTTTAGGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1749s21c1
Sequence:CCGGGGCATTACTCTAACCCTAAATCTCGAGATTTAGGGTTAGAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198566
VALIDATED
C5orf34 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 34
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-573s1c1
Sequence:CCGGGAAACCATCATACCTTCTGAACTCGAGTTCAGAAGGTATGATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-694s1c1
Sequence:CCGGCATCTTTAGATGGTCATGCATCTCGAGATGCATGACCATCTAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-1134s1c1
Sequence:CCGGGCACATATAACTCAGAGTAGACTCGAGTCTACTCTGAGTTATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198566.1-1710s1c1
Sequence:CCGGGCCTACTCTGATGACAAAGTACTCGAGTACTTTGTCATCAGAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1848s1c1
Sequence:CCGGGATGGACAAGAGCAGTTAATTCTCGAGAATTAACTGCTCTTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198566.1-2196s1c1
Sequence:CCGGCACGATATTGACTGTCTTCTACTCGAGTAGAAGACAGTCAATATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-1635s1c1
Sequence:CCGGCCTGGGATAAATGATAGCAATCTCGAGATTGCTATCATTTATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198566.1-453s1c1
Sequence:CCGGCCTTTAGAACAACCAGAAAGACTCGAGTCTTTCTGGTTGTTCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198566.1-2275s1c1
Sequence:CCGGGTTGTTTCAAGTGACTGGTATCTCGAGATACCAGTCACTTGAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198566.1-637s1c1
Sequence:CCGGCCAGTCTTGATACAGATGGTACTCGAGTACCATCTGTATCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1949s21c1
Sequence:CCGGCAGAGAGATGCCCACTCATTCCTCGAGGAATGAGTGGGCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-946s21c1
Sequence:CCGGAGAAGATGAGTTGTGTAAATGCTCGAGCATTTACACAACTCATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1872s21c1
Sequence:CCGGATTGAACACCCTGAACCATATCTCGAGATATGGTTCAGGGTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1079s21c1
Sequence:CCGGTTTGTCTTTAGCACTTCATTTCTCGAGAAATGAAGTGCTAAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-353s21c1
Sequence:CCGGTGATTCAGTACAAGTACAATACTCGAGTATTGTACTTGTACTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2029s21c1
Sequence:CCGGAGTTTAACTTGCTACTAGAAACTCGAGTTTCTAGTAGCAAGTTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-2054s21c1
Sequence:CCGGTGGTATCCTAAACCAGATTTCCTCGAGGAAATCTGGTTTAGGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198566.1-1749s21c1
Sequence:CCGGGGCATTACTCTAACCCTAAATCTCGAGATTTAGGGTTAGAGTAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks