EMAIL THIS PAGE TO A FRIEND

C5orf42

chromosome 5 open reading frame 42

44 Gene Product Result for
Synonyms: JBTS17
Species: Human C5orf42(65250)
Gene ID:
Human(65250) Summary: The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023073 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064171 MISSION® esiRNA esiRNA human C5orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023073 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233134 predicted 4263
2 SASI_Hs02_00356311 predicted 2708
3 SASI_Hs01_00233136 predicted 1152
4 SASI_Hs02_00356312 predicted 6711
5 SASI_Hs01_00233137 predicted 2752
6 SASI_Hs01_00233138 predicted 3840
7 SASI_Hs01_00233139 predicted 3955
8 SASI_Hs01_00233140 predicted 3220
9 SASI_Hs01_00233141 predicted 6725
10 SASI_Hs02_00356313 predicted 1845
11 SASI_Hs01_00233135 predicted 1292
12 SASI_Hs01_00233142 predicted 2258
13 SASI_Hs01_00233143 predicted 6346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023073
C5orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 42
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023073.2-6376s1c1
Sequence:CCGGGTCTGATGAATGAACTGTTATCTCGAGATAACAGTTCATTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023073.2-7300s21c1
Sequence:CCGGATGCATCATTAGGCATAATTTCTCGAGAAATTATGCCTAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-6551s21c1
Sequence:CCGGTATGTCCAAACCGAGTTATATCTCGAGATATAACTCGGTTTGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-1038s21c1
Sequence:CCGGCCTGTAGCACAGTGGTATATACTCGAGTATATACCACTGTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-5357s21c1
Sequence:CCGGATCGTCTGCAGAGTTACATTACTCGAGTAATGTAACTCTGCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-2582s21c1
Sequence:CCGGAGCTATTCAGTGCAATGATATCTCGAGATATCATTGCACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023073
C5orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 42
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023073.2-6376s1c1
Sequence:CCGGGTCTGATGAATGAACTGTTATCTCGAGATAACAGTTCATTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023073.2-7300s21c1
Sequence:CCGGATGCATCATTAGGCATAATTTCTCGAGAAATTATGCCTAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-6551s21c1
Sequence:CCGGTATGTCCAAACCGAGTTATATCTCGAGATATAACTCGGTTTGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-1038s21c1
Sequence:CCGGCCTGTAGCACAGTGGTATATACTCGAGTATATACCACTGTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-5357s21c1
Sequence:CCGGATCGTCTGCAGAGTTACATTACTCGAGTAATGTAACTCTGCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-2582s21c1
Sequence:CCGGAGCTATTCAGTGCAATGATATCTCGAGATATCATTGCACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023073
C5orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 42
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023073.2-6376s1c1
Sequence:CCGGGTCTGATGAATGAACTGTTATCTCGAGATAACAGTTCATTCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023073.2-7300s21c1
Sequence:CCGGATGCATCATTAGGCATAATTTCTCGAGAAATTATGCCTAATGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-6551s21c1
Sequence:CCGGTATGTCCAAACCGAGTTATATCTCGAGATATAACTCGGTTTGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-1038s21c1
Sequence:CCGGCCTGTAGCACAGTGGTATATACTCGAGTATATACCACTGTGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-5357s21c1
Sequence:CCGGATCGTCTGCAGAGTTACATTACTCGAGTAATGTAACTCTGCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023073.2-2582s21c1
Sequence:CCGGAGCTATTCAGTGCAATGATATCTCGAGATATCATTGCACTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks