EMAIL THIS PAGE TO A FRIEND

C5orf45

chromosome 5 open reading frame 45

75 Gene Product Result for
Species: Human C5orf45(51149)
UniProtKB ID: Q6NTE8, B5MD09, E9PAK6, Q7Z3D8, Q9BUC1, Q9UN54
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016175 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159181 MISSION® esiRNA esiRNA human C5orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017987 Rosetta Predictions human pricing
NM_001018061 Rosetta Predictions human pricing
NM_001018062 Rosetta Predictions human pricing
NM_016175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123009 predicted 605
2 SASI_Hs01_00123010 predicted 548
3 SASI_Hs01_00123011 predicted 601
4 SASI_Hs01_00123012 predicted 710
5 SASI_Hs01_00123013 predicted 744
6 SASI_Hs01_00123014 predicted 369
7 SASI_Hs01_00123016 predicted 520
8 SASI_Hs01_00123017 predicted 643
9 SASI_Hs02_00306873 predicted 749
10 SASI_Hs02_00306874 predicted 552
11 SASI_Hs01_00123008 predicted 542
12 SASI_Hs01_00123015 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060274 predicted 620
2 SASI_Hs01_00060275 predicted 690
3 SASI_Hs01_00060276 predicted 636
4 SASI_Hs01_00060277 predicted 686
5 SASI_Hs01_00060278 predicted 446
6 SASI_Hs01_00060279 predicted 593
7 SASI_Hs01_00060280 predicted 641
8 SASI_Hs01_00060281 predicted 266
9 SASI_Hs01_00060282 predicted 385
10 SASI_Hs01_00060283 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178865 predicted 793
2 SASI_Hs01_00178866 predicted 799
3 SASI_Hs01_00178867 predicted 618
4 SASI_Hs01_00178868 predicted 767
5 SASI_Hs01_00178869 predicted 337
6 SASI_Hs01_00178870 predicted 555
7 SASI_Hs01_00178871 predicted 433
8 SASI_Hs01_00178872 predicted 489
9 SASI_Hs01_00178873 predicted 238
10 SASI_Hs01_00178874 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152764 predicted 778
2 SASI_Hs01_00152765 predicted 719
3 SASI_Hs01_00152766 predicted 770
4 SASI_Hs01_00152767 predicted 873
5 SASI_Hs01_00152768 predicted 912
6 SASI_Hs01_00152769 predicted 536
7 SASI_Hs01_00152771 predicted 684
8 SASI_Hs01_00152772 predicted 812
9 SASI_Hs02_00348988 predicted 910
10 SASI_Hs02_00348989 predicted 714
11 SASI_Hs01_00152763 predicted 712
12 SASI_Hs01_00152770 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016175
VALIDATED
C5orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 45
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-358s21c1
Sequence:CCGGGTCGCTGGCTGAAGTATCTAGCTCGAGCTAGATACTTCAGCCAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-220s21c1
Sequence:CCGGTAAATCTACTACAGGGACAAGCTCGAGCTTGTCCCTGTAGTAGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-121s21c1
Sequence:CCGGGTGTCAAGTGGACATGCAAAGCTCGAGCTTTGCATGTCCACTTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016175.1-646s1c1
Sequence:CCGGCGACTATGTGACCTCTTTATACTCGAGTATAAAGAGGTCACATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-300s1c1
Sequence:CCGGGAAGGAGCTATGGAGTCCCATCTCGAGATGGGACTCCATAGCTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-642s1c1
Sequence:CCGGCACACGACTATGTGACCTCTTCTCGAGAAGAGGTCACATAGTCGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016175
VALIDATED
C5orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 45
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-358s21c1
Sequence:CCGGGTCGCTGGCTGAAGTATCTAGCTCGAGCTAGATACTTCAGCCAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-220s21c1
Sequence:CCGGTAAATCTACTACAGGGACAAGCTCGAGCTTGTCCCTGTAGTAGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-121s21c1
Sequence:CCGGGTGTCAAGTGGACATGCAAAGCTCGAGCTTTGCATGTCCACTTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016175.1-646s1c1
Sequence:CCGGCGACTATGTGACCTCTTTATACTCGAGTATAAAGAGGTCACATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-300s1c1
Sequence:CCGGGAAGGAGCTATGGAGTCCCATCTCGAGATGGGACTCCATAGCTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-642s1c1
Sequence:CCGGCACACGACTATGTGACCTCTTCTCGAGAAGAGGTCACATAGTCGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016175
VALIDATED
C5orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 45
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-358s21c1
Sequence:CCGGGTCGCTGGCTGAAGTATCTAGCTCGAGCTAGATACTTCAGCCAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-220s21c1
Sequence:CCGGTAAATCTACTACAGGGACAAGCTCGAGCTTGTCCCTGTAGTAGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016175.3-121s21c1
Sequence:CCGGGTGTCAAGTGGACATGCAAAGCTCGAGCTTTGCATGTCCACTTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016175.1-646s1c1
Sequence:CCGGCGACTATGTGACCTCTTTATACTCGAGTATAAAGAGGTCACATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-300s1c1
Sequence:CCGGGAAGGAGCTATGGAGTCCCATCTCGAGATGGGACTCCATAGCTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016175.1-642s1c1
Sequence:CCGGCACACGACTATGTGACCTCTTCTCGAGAAGAGGTCACATAGTCGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)