EMAIL THIS PAGE TO A FRIEND

C5orf46

chromosome 5 open reading frame 46

39 Gene Product Result for
Species: Human C5orf46(389336)
UniProtKB ID: Q6UWT4, A8K038, Q8WU04
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA058999 Anti-C5orf46 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206966 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056461 MISSION® esiRNA esiRNA human C5orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206966 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073984 predicted 243
2 SASI_Hs02_00373671 predicted 223
3 SASI_Hs01_00073985 predicted 291
4 SASI_Hs01_00073986 predicted 251
5 SASI_Hs01_00073987 predicted 302
6 SASI_Hs01_00073988 predicted 249
7 SASI_Hs02_00373672 predicted 204
8 SASI_Hs02_00373673 predicted 196
9 SASI_Hs02_00373674 predicted 204
10 SASI_Hs01_00073989 predicted 249
11 SASI_Hs01_00073983 predicted 225
12 SASI_Hs01_00073990 predicted 225
13 SASI_Hs01_00073991 predicted 218
14 SASI_Hs01_00073992 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206966
C5orf46 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 46
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206966.1-364s1c1
Sequence:CCGGCAAAGCAACTCCCAACGAGTTCTCGAGAACTCGTTGGGAGTTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-34s1c1
Sequence:CCGGCCTGGGACTGCTTGTCTTATTCTCGAGAATAAGACAAGCAGTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-162s1c1
Sequence:CCGGCAGAGATCATTGAGAATGCAGCTCGAGCTGCATTCTCAATGATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-47s1c1
Sequence:CCGGGTCTTATTCCTGACCTGCTATCTCGAGATAGCAGGTCAGGAATAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-175s1c1
Sequence:CCGGGAATGCAGTCGAGTTCATCCTCTCGAGAGGATGAACTCGACTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-296s1c1
Sequence:CCGGGACAATCCAAGAGCAGCCAAACTCGAGTTTGGCTGCTCTTGGATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-169s1c1
Sequence:CCGGCATTGAGAATGCAGTCGAGTTCTCGAGAACTCGACTGCATTCTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-39s1c1
Sequence:CCGGGACTGCTTGTCTTATTCCTGACTCGAGTCAGGAATAAGACAAGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-214s1c1
Sequence:CCGGCACAGGATTTATGGAATTTGACTCGAGTCAAATTCCATAAATCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-213s1c1
Sequence:CCGGGCACAGGATTTATGGAATTTGCTCGAGCAAATTCCATAAATCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206966
C5orf46 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 46
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206966.1-364s1c1
Sequence:CCGGCAAAGCAACTCCCAACGAGTTCTCGAGAACTCGTTGGGAGTTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-34s1c1
Sequence:CCGGCCTGGGACTGCTTGTCTTATTCTCGAGAATAAGACAAGCAGTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-162s1c1
Sequence:CCGGCAGAGATCATTGAGAATGCAGCTCGAGCTGCATTCTCAATGATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-47s1c1
Sequence:CCGGGTCTTATTCCTGACCTGCTATCTCGAGATAGCAGGTCAGGAATAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-175s1c1
Sequence:CCGGGAATGCAGTCGAGTTCATCCTCTCGAGAGGATGAACTCGACTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-296s1c1
Sequence:CCGGGACAATCCAAGAGCAGCCAAACTCGAGTTTGGCTGCTCTTGGATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-169s1c1
Sequence:CCGGCATTGAGAATGCAGTCGAGTTCTCGAGAACTCGACTGCATTCTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-39s1c1
Sequence:CCGGGACTGCTTGTCTTATTCCTGACTCGAGTCAGGAATAAGACAAGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-214s1c1
Sequence:CCGGCACAGGATTTATGGAATTTGACTCGAGTCAAATTCCATAAATCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-213s1c1
Sequence:CCGGGCACAGGATTTATGGAATTTGCTCGAGCAAATTCCATAAATCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206966
C5orf46 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 46
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166451    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206966.1-364s1c1
Sequence:CCGGCAAAGCAACTCCCAACGAGTTCTCGAGAACTCGTTGGGAGTTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-34s1c1
Sequence:CCGGCCTGGGACTGCTTGTCTTATTCTCGAGAATAAGACAAGCAGTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-162s1c1
Sequence:CCGGCAGAGATCATTGAGAATGCAGCTCGAGCTGCATTCTCAATGATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-47s1c1
Sequence:CCGGGTCTTATTCCTGACCTGCTATCTCGAGATAGCAGGTCAGGAATAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-175s1c1
Sequence:CCGGGAATGCAGTCGAGTTCATCCTCTCGAGAGGATGAACTCGACTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-296s1c1
Sequence:CCGGGACAATCCAAGAGCAGCCAAACTCGAGTTTGGCTGCTCTTGGATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-169s1c1
Sequence:CCGGCATTGAGAATGCAGTCGAGTTCTCGAGAACTCGACTGCATTCTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-39s1c1
Sequence:CCGGGACTGCTTGTCTTATTCCTGACTCGAGTCAGGAATAAGACAAGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-214s1c1
Sequence:CCGGCACAGGATTTATGGAATTTGACTCGAGTCAAATTCCATAAATCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206966.1-213s1c1
Sequence:CCGGGCACAGGATTTATGGAATTTGCTCGAGCAAATTCCATAAATCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)