EMAIL THIS PAGE TO A FRIEND

C5orf47

chromosome 5 open reading frame 47

38 Gene Product Result for
Species: Human C5orf47(133491)
UniProtKB ID: Q569G3, Q8IYU7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144954 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715744 Rosetta Predictions human pricing
XM_376444 Rosetta Predictions human pricing
XM_941190 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405827 predicted 779
2 SASI_Hs02_00405828 predicted 889
3 SASI_Hs02_00405829 predicted 1055
4 SASI_Hs02_00405830 predicted 807
5 SASI_Hs02_00405831 predicted 1054
6 SASI_Hs02_00405832 predicted 818
7 SASI_Hs02_00405833 predicted 878
8 SASI_Hs02_00405834 predicted 672
9 SASI_Hs02_00405835 predicted 1037
10 SASI_Hs02_00405836 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295948 predicted 779
2 SASI_Hs02_00479720 predicted 887
3 SASI_Hs01_00295950 predicted 1048
4 SASI_Hs01_00295951 predicted 806
5 SASI_Hs01_00295952 predicted 1045
6 SASI_Hs02_00479721 predicted 817
7 SASI_Hs01_00295954 predicted 884
8 SASI_Hs01_00295955 predicted 674
9 SASI_Hs02_00479722 predicted 1037
10 SASI_Hs01_00295956 predicted 723
11 SASI_Hs01_00295949 predicted 1071
12 SASI_Hs01_00295953 predicted 837
13 SASI_Hs01_00295957 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484718 predicted 783
2 SASI_Hs02_00484719 predicted 892
3 SASI_Hs02_00484720 predicted 1046
4 SASI_Hs02_00484721 predicted 802
5 SASI_Hs02_00484722 predicted 1052
6 SASI_Hs02_00484723 predicted 816
7 SASI_Hs02_00484724 predicted 887
8 SASI_Hs02_00484725 predicted 674
9 SASI_Hs02_00484726 predicted 1036
10 SASI_Hs02_00484727 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144954
C5orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 47
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-576s21c1
Sequence:CCGGATATAGACACAGGCTGAAATGCTCGAGCATTTCAGCCTGTGTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-520s21c1
Sequence:CCGGTTAGTATGGAATAGAGTATACCTCGAGGTATACTCTATTCCATACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-475s21c1
Sequence:CCGGCCATTGAATGAAGCTTCCAAACTCGAGTTTGGAAGCTTCATTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144954.1-1116s21c1
Sequence:CCGGGAATTTACATAGCAACGATTACTCGAGTAATCGTTGCTATGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-607s21c1
Sequence:CCGGTCTAGTGAAAGCTCAAATTACCTCGAGGTAATTTGAGCTTTCACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144954
C5orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 47
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-576s21c1
Sequence:CCGGATATAGACACAGGCTGAAATGCTCGAGCATTTCAGCCTGTGTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-520s21c1
Sequence:CCGGTTAGTATGGAATAGAGTATACCTCGAGGTATACTCTATTCCATACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-475s21c1
Sequence:CCGGCCATTGAATGAAGCTTCCAAACTCGAGTTTGGAAGCTTCATTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144954.1-1116s21c1
Sequence:CCGGGAATTTACATAGCAACGATTACTCGAGTAATCGTTGCTATGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-607s21c1
Sequence:CCGGTCTAGTGAAAGCTCAAATTACCTCGAGGTAATTTGAGCTTTCACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144954
C5orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 47
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-576s21c1
Sequence:CCGGATATAGACACAGGCTGAAATGCTCGAGCATTTCAGCCTGTGTCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-520s21c1
Sequence:CCGGTTAGTATGGAATAGAGTATACCTCGAGGTATACTCTATTCCATACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-475s21c1
Sequence:CCGGCCATTGAATGAAGCTTCCAAACTCGAGTTTGGAAGCTTCATTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144954.1-1116s21c1
Sequence:CCGGGAATTTACATAGCAACGATTACTCGAGTAATCGTTGCTATGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144954.1-607s21c1
Sequence:CCGGTCTAGTGAAAGCTCAAATTACCTCGAGGTAATTTGAGCTTTCACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks