EMAIL THIS PAGE TO A FRIEND

C5orf48

chromosome 5 open reading frame 48

16 Gene Product Result for
Species: Human C5orf48(389320)
UniProtKB ID: Q6ZNM6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043794 Anti-TEX43 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151271 MISSION® esiRNA esiRNA human C5orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207408 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043949 predicted 208
2 SASI_Hs01_00043950 predicted 234
3 SASI_Hs01_00043951 predicted 224
4 SASI_Hs01_00043952 predicted 205
5 SASI_Hs01_00043953 predicted 231
6 SASI_Hs01_00043954 predicted 219
7 SASI_Hs01_00043955 predicted 227
8 SASI_Hs01_00043956 predicted 223
9 SASI_Hs01_00043957 predicted 222
10 SASI_Hs01_00043958 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207408
C5orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-225s21c1
Sequence:CCGGGGATCCATACTGGCCCTTTAGCTCGAGCTAAAGGGCCAGTATGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-43s21c1
Sequence:CCGGTTTGCCTAAACTCACTAACAACTCGAGTTGTTAGTGAGTTTAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-262s21c1
Sequence:CCGGGAATCACAGTGAAAGGCTTTGCTCGAGCAAAGCCTTTCACTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-197s21c1
Sequence:CCGGGTGAATCTGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-155s1c1
Sequence:CCGGCGTTATGTCATGCCTTGGAAACTCGAGTTTCCAAGGCATGACATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-76s1c1
Sequence:CCGGGAGTCTCTATAAATCTGCTAACTCGAGTTAGCAGATTTATAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-107s1c1
Sequence:CCGGGAGATTCATTTGCCACGATTTCTCGAGAAATCGTGGCAAATGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-145s1c1
Sequence:CCGGGATCCCAAGACGTTATGTCATCTCGAGATGACATAACGTCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-66s1c1
Sequence:CCGGGCTCTGATGAGAGTCTCTATACTCGAGTATAGAGACTCTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207408
C5orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-225s21c1
Sequence:CCGGGGATCCATACTGGCCCTTTAGCTCGAGCTAAAGGGCCAGTATGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-43s21c1
Sequence:CCGGTTTGCCTAAACTCACTAACAACTCGAGTTGTTAGTGAGTTTAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-262s21c1
Sequence:CCGGGAATCACAGTGAAAGGCTTTGCTCGAGCAAAGCCTTTCACTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-197s21c1
Sequence:CCGGGTGAATCTGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-155s1c1
Sequence:CCGGCGTTATGTCATGCCTTGGAAACTCGAGTTTCCAAGGCATGACATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-76s1c1
Sequence:CCGGGAGTCTCTATAAATCTGCTAACTCGAGTTAGCAGATTTATAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-107s1c1
Sequence:CCGGGAGATTCATTTGCCACGATTTCTCGAGAAATCGTGGCAAATGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-145s1c1
Sequence:CCGGGATCCCAAGACGTTATGTCATCTCGAGATGACATAACGTCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-66s1c1
Sequence:CCGGGCTCTGATGAGAGTCTCTATACTCGAGTATAGAGACTCTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207408
C5orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-225s21c1
Sequence:CCGGGGATCCATACTGGCCCTTTAGCTCGAGCTAAAGGGCCAGTATGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-43s21c1
Sequence:CCGGTTTGCCTAAACTCACTAACAACTCGAGTTGTTAGTGAGTTTAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-262s21c1
Sequence:CCGGGAATCACAGTGAAAGGCTTTGCTCGAGCAAAGCCTTTCACTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207408.1-197s21c1
Sequence:CCGGGTGAATCTGAAGCAAGCAGAACTCGAGTTCTGCTTGCTTCAGATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-155s1c1
Sequence:CCGGCGTTATGTCATGCCTTGGAAACTCGAGTTTCCAAGGCATGACATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-76s1c1
Sequence:CCGGGAGTCTCTATAAATCTGCTAACTCGAGTTAGCAGATTTATAGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-107s1c1
Sequence:CCGGGAGATTCATTTGCCACGATTTCTCGAGAAATCGTGGCAAATGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-145s1c1
Sequence:CCGGGATCCCAAGACGTTATGTCATCTCGAGATGACATAACGTCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207408.1-66s1c1
Sequence:CCGGGCTCTGATGAGAGTCTCTATACTCGAGTATAGAGACTCTCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks