EMAIL THIS PAGE TO A FRIEND

C5orf49

chromosome 5 open reading frame 49

27 Gene Product Result for
Species: Human C5orf49(134121)
UniProtKB ID: A4QMS7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001089584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001089584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001089584 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222301 MISSION® esiRNA esiRNA targeting human C5orf49 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001089584 Rosetta Predictions human pricing
XM_376372 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001089584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318018 predicted 408
2 SASI_Hs02_00318019 predicted 421
3 SASI_Hs02_00318020 predicted 684
4 SASI_Hs02_00318021 predicted 485
5 SASI_Hs02_00318022 predicted 683
6 SASI_Hs02_00318023 predicted 761
7 SASI_Hs02_00318024 predicted 367
8 SASI_Hs02_00318025 predicted 471
9 SASI_Hs02_00318026 predicted 471
10 SASI_Hs02_00318027 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258637 predicted 1158
2 SASI_Hs01_00258638 predicted 1183
3 SASI_Hs01_00258639 predicted 1436
4 SASI_Hs01_00258640 predicted 1241
5 SASI_Hs01_00258641 predicted 1650
6 SASI_Hs01_00258642 predicted 1722
7 SASI_Hs01_00258643 predicted 1517
8 SASI_Hs01_00258644 predicted 1120
9 SASI_Hs01_00258645 predicted 1686
10 SASI_Hs01_00258646 predicted 1605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001089584
C5orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 49
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089584.1-764s21c1
Sequence:CCGGGCCTGACCAACAACACCTTTACTCGAGTAAAGGTGTTGTTGGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-432s21c1
Sequence:CCGGTCTATGGGAAGCGCATCAATCCTCGAGGATTGATGCGCTTCCCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-287s21c1
Sequence:CCGGATTTCCCTCTATGATTGTATTCTCGAGAATACAATCATAGAGGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-309s21c1
Sequence:CCGGTTAAGAGGCGCCTAGATTATGCTCGAGCATAATCTAGGCGCCTCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-368s21c1
Sequence:CCGGAGCCTGGGACTTCATGTTAACCTCGAGGTTAACATGAAGTCCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001089584
C5orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 49
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089584.1-764s21c1
Sequence:CCGGGCCTGACCAACAACACCTTTACTCGAGTAAAGGTGTTGTTGGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-432s21c1
Sequence:CCGGTCTATGGGAAGCGCATCAATCCTCGAGGATTGATGCGCTTCCCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-287s21c1
Sequence:CCGGATTTCCCTCTATGATTGTATTCTCGAGAATACAATCATAGAGGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-309s21c1
Sequence:CCGGTTAAGAGGCGCCTAGATTATGCTCGAGCATAATCTAGGCGCCTCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-368s21c1
Sequence:CCGGAGCCTGGGACTTCATGTTAACCTCGAGGTTAACATGAAGTCCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001089584
C5orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 49
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089584.1-764s21c1
Sequence:CCGGGCCTGACCAACAACACCTTTACTCGAGTAAAGGTGTTGTTGGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-432s21c1
Sequence:CCGGTCTATGGGAAGCGCATCAATCCTCGAGGATTGATGCGCTTCCCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-287s21c1
Sequence:CCGGATTTCCCTCTATGATTGTATTCTCGAGAATACAATCATAGAGGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-309s21c1
Sequence:CCGGTTAAGAGGCGCCTAGATTATGCTCGAGCATAATCTAGGCGCCTCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089584.1-368s21c1
Sequence:CCGGAGCCTGGGACTTCATGTTAACCTCGAGGTTAACATGAAGTCCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)