EMAIL THIS PAGE TO A FRIEND

C5orf51

chromosome 5 open reading frame 51

Species: Human C5orf51(285636)
UniProtKB ID: A6NDU8, A2RRM9
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229031 MISSION® esiRNA esiRNA targeting human C5orf51 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369178 predicted 482
2 SASI_Hs01_00116059 predicted 859
3 SASI_Hs01_00116060 predicted 866
4 SASI_Hs01_00116061 predicted 490
5 SASI_Hs01_00116062 predicted 540
6 SASI_Hs01_00116063 predicted 256
7 SASI_Hs01_00116064 predicted 526
8 SASI_Hs01_00116065 predicted 518
9 SASI_Hs01_00116066 predicted 874
10 SASI_Hs01_00116067 predicted 609
11 SASI_Hs01_00116068 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175921
VALIDATED
C5orf51 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 51
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-611s1c1
Sequence:CCGGGTGACATTCATCTGCTGGCTACTCGAGTAGCCAGCAGATGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3385s1c1
Sequence:CCGGGCTCCTTTGTTCTGGTCCTTTCTCGAGAAAGGACCAGAACAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-864s1c1
Sequence:CCGGCTTTCATCATCGCTGTAACTACTCGAGTAGTTACAGCGATGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175921.4-584s1c1
Sequence:CCGGCTAAATTACTGAGTGCAGGAACTCGAGTTCCTGCACTCAGTAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3827s1c1
Sequence:CCGGCCCACACAGTTGGAGAATAATCTCGAGATTATTCTCCAACTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-235s1c1
Sequence:CCGGGAGAACAAGCTAGTAGATGAACTCGAGTTCATCTACTAGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175921.4-2039s1c1
Sequence:CCGGCCTCAGCTTTATGGGATACTACTCGAGTAGTATCCCATAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-628s1c1
Sequence:CCGGGCTATGATGTACAGTGGAGAACTCGAGTTCTCCACTGTACATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-731s1c1
Sequence:CCGGGCACTACATACAAGGAACCCTCTCGAGAGGGTTCCTTGTATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175921
VALIDATED
C5orf51 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 51
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-611s1c1
Sequence:CCGGGTGACATTCATCTGCTGGCTACTCGAGTAGCCAGCAGATGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3385s1c1
Sequence:CCGGGCTCCTTTGTTCTGGTCCTTTCTCGAGAAAGGACCAGAACAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-864s1c1
Sequence:CCGGCTTTCATCATCGCTGTAACTACTCGAGTAGTTACAGCGATGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175921.4-584s1c1
Sequence:CCGGCTAAATTACTGAGTGCAGGAACTCGAGTTCCTGCACTCAGTAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3827s1c1
Sequence:CCGGCCCACACAGTTGGAGAATAATCTCGAGATTATTCTCCAACTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-235s1c1
Sequence:CCGGGAGAACAAGCTAGTAGATGAACTCGAGTTCATCTACTAGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175921.4-2039s1c1
Sequence:CCGGCCTCAGCTTTATGGGATACTACTCGAGTAGTATCCCATAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-628s1c1
Sequence:CCGGGCTATGATGTACAGTGGAGAACTCGAGTTCTCCACTGTACATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-731s1c1
Sequence:CCGGGCACTACATACAAGGAACCCTCTCGAGAGGGTTCCTTGTATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175921
VALIDATED
C5orf51 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 51
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-611s1c1
Sequence:CCGGGTGACATTCATCTGCTGGCTACTCGAGTAGCCAGCAGATGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3385s1c1
Sequence:CCGGGCTCCTTTGTTCTGGTCCTTTCTCGAGAAAGGACCAGAACAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175921.4-864s1c1
Sequence:CCGGCTTTCATCATCGCTGTAACTACTCGAGTAGTTACAGCGATGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175921.4-584s1c1
Sequence:CCGGCTAAATTACTGAGTGCAGGAACTCGAGTTCCTGCACTCAGTAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-3827s1c1
Sequence:CCGGCCCACACAGTTGGAGAATAATCTCGAGATTATTCTCCAACTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175921.4-235s1c1
Sequence:CCGGGAGAACAAGCTAGTAGATGAACTCGAGTTCATCTACTAGCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175921.4-2039s1c1
Sequence:CCGGCCTCAGCTTTATGGGATACTACTCGAGTAGTATCCCATAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-628s1c1
Sequence:CCGGGCTATGATGTACAGTGGAGAACTCGAGTTCTCCACTGTACATCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_175921.4-731s1c1
Sequence:CCGGGCACTACATACAAGGAACCCTCTCGAGAGGGTTCCTTGTATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks