EMAIL THIS PAGE TO A FRIEND

C5orf52

chromosome 5 open reading frame 52

4 Gene Product Result for
Species: Human C5orf52(100190949)
UniProtKB ID: A6NGY3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145132
C5orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 52
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-260s21c1
Sequence:CCGGGCCGGTGCTGTTCAGCTTAATCTCGAGATTAAGCTGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-322s21c1
Sequence:CCGGGCCATTTATCTCGGGTGATTACTCGAGTAATCACCCGAGATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-355s21c1
Sequence:CCGGGCATCACACAACGAATCTATGCTCGAGCATAGATTCGTTGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-496s21c1
Sequence:CCGGTGAACAGCAACCGGTACTTAACTCGAGTTAAGTACCGGTTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-523s21c1
Sequence:CCGGGGATACCACCACCAGTTTAAACTCGAGTTTAAACTGGTGGTGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145132
C5orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 52
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-260s21c1
Sequence:CCGGGCCGGTGCTGTTCAGCTTAATCTCGAGATTAAGCTGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-322s21c1
Sequence:CCGGGCCATTTATCTCGGGTGATTACTCGAGTAATCACCCGAGATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-355s21c1
Sequence:CCGGGCATCACACAACGAATCTATGCTCGAGCATAGATTCGTTGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-496s21c1
Sequence:CCGGTGAACAGCAACCGGTACTTAACTCGAGTTAAGTACCGGTTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-523s21c1
Sequence:CCGGGGATACCACCACCAGTTTAAACTCGAGTTTAAACTGGTGGTGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145132
C5orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 52
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-260s21c1
Sequence:CCGGGCCGGTGCTGTTCAGCTTAATCTCGAGATTAAGCTGAACAGCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-322s21c1
Sequence:CCGGGCCATTTATCTCGGGTGATTACTCGAGTAATCACCCGAGATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-355s21c1
Sequence:CCGGGCATCACACAACGAATCTATGCTCGAGCATAGATTCGTTGTGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-496s21c1
Sequence:CCGGTGAACAGCAACCGGTACTTAACTCGAGTTAAGTACCGGTTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145132.1-523s21c1
Sequence:CCGGGGATACCACCACCAGTTTAAACTCGAGTTTAAACTGGTGGTGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks