EMAIL THIS PAGE TO A FRIEND

C5orf54

chromosome 5 open reading frame 54

25 Gene Product Result for
Synonyms: Buster3 ZBED8
Species: Human C5orf54(63920)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022090 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125761 MISSION® esiRNA esiRNA human C5orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022090 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192935 predicted 2686
2 SASI_Hs02_00355473 predicted 2439
3 SASI_Hs02_00355474 predicted 2688
4 SASI_Hs01_00192936 predicted 2648
5 SASI_Hs01_00192938 predicted 2689
6 SASI_Hs01_00192939 predicted 2526
7 SASI_Hs01_00192940 predicted 2622
8 SASI_Hs01_00192941 predicted 2488
9 SASI_Hs01_00192943 predicted 2772
10 SASI_Hs01_00192944 predicted 2761
11 SASI_Hs01_00192937 predicted 2465
12 SASI_Hs01_00192942 predicted 2516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022090
VALIDATED
C5orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 54
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-747s21c1
Sequence:CCGGTCGTATCAATTTGCGTATTTACTCGAGTAAATACGCAAATTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1829s21c1
Sequence:CCGGCAACTTCTTCCATGGATATTTCTCGAGAAATATCCATGGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1339s21c1
Sequence:CCGGTTACTGTGGTGAGGGTAATAACTCGAGTTATTACCCTCACCACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022090.3-2629s21c1
Sequence:CCGGCTTTGTTATGGAGAGGTTAATCTCGAGATTAACCTCTCCATAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1029s21c1
Sequence:CCGGATGGCATTTGTGCGCTATATACTCGAGTATATAGCGCACAAATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-2258s1c1
Sequence:CCGGCCTCGTTTCTCGGACATCATTCTCGAGAATGATGTCCGAGAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-709s1c1
Sequence:CCGGGCATGATCTCAATAGCCTGAACTCGAGTTCAGGCTATTGAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-2041s1c1
Sequence:CCGGCCTAATGGAATTTGAGACAATCTCGAGATTGTCTCAAATTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-809s1c1
Sequence:CCGGGCATCGTATCAATTTGCGTATCTCGAGATACGCAAATTGATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-1848s1c1
Sequence:CCGGGCATATTCATTGCAGCTGAAACTCGAGTTTCAGCTGCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022090.2-1937s1c1
Sequence:CCGGGCAAGTAAATGGATATTGGATCTCGAGATCCAATATCCATTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1319s1c1
Sequence:CCGGCCTCATATCGTAGTTACACATCTCGAGATGTGTAACTACGATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1442s1c1
Sequence:CCGGGCTCCAAATCATCGCCTATTTCTCGAGAAATAGGCGATGATTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1159s1c1
Sequence:CCGGGCAGCTATCCATGAAAGGAATCTCGAGATTCCTTTCATGGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-836s1c1
Sequence:CCGGGCCAAGGAGAAGAATCCTCATCTCGAGATGAGGATTCTTCTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-2293s1c1
Sequence:CCGGGCTACAGCAGAAGTCACTGTACTCGAGTACAGTGACTTCTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022090
VALIDATED
C5orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 54
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-747s21c1
Sequence:CCGGTCGTATCAATTTGCGTATTTACTCGAGTAAATACGCAAATTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1829s21c1
Sequence:CCGGCAACTTCTTCCATGGATATTTCTCGAGAAATATCCATGGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1339s21c1
Sequence:CCGGTTACTGTGGTGAGGGTAATAACTCGAGTTATTACCCTCACCACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022090.3-2629s21c1
Sequence:CCGGCTTTGTTATGGAGAGGTTAATCTCGAGATTAACCTCTCCATAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1029s21c1
Sequence:CCGGATGGCATTTGTGCGCTATATACTCGAGTATATAGCGCACAAATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-2258s1c1
Sequence:CCGGCCTCGTTTCTCGGACATCATTCTCGAGAATGATGTCCGAGAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-709s1c1
Sequence:CCGGGCATGATCTCAATAGCCTGAACTCGAGTTCAGGCTATTGAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-2041s1c1
Sequence:CCGGCCTAATGGAATTTGAGACAATCTCGAGATTGTCTCAAATTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-809s1c1
Sequence:CCGGGCATCGTATCAATTTGCGTATCTCGAGATACGCAAATTGATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-1848s1c1
Sequence:CCGGGCATATTCATTGCAGCTGAAACTCGAGTTTCAGCTGCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022090.2-1937s1c1
Sequence:CCGGGCAAGTAAATGGATATTGGATCTCGAGATCCAATATCCATTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1319s1c1
Sequence:CCGGCCTCATATCGTAGTTACACATCTCGAGATGTGTAACTACGATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1442s1c1
Sequence:CCGGGCTCCAAATCATCGCCTATTTCTCGAGAAATAGGCGATGATTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1159s1c1
Sequence:CCGGGCAGCTATCCATGAAAGGAATCTCGAGATTCCTTTCATGGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-836s1c1
Sequence:CCGGGCCAAGGAGAAGAATCCTCATCTCGAGATGAGGATTCTTCTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-2293s1c1
Sequence:CCGGGCTACAGCAGAAGTCACTGTACTCGAGTACAGTGACTTCTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022090
VALIDATED
C5orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 54
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-747s21c1
Sequence:CCGGTCGTATCAATTTGCGTATTTACTCGAGTAAATACGCAAATTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1829s21c1
Sequence:CCGGCAACTTCTTCCATGGATATTTCTCGAGAAATATCCATGGAAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1339s21c1
Sequence:CCGGTTACTGTGGTGAGGGTAATAACTCGAGTTATTACCCTCACCACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022090.3-2629s21c1
Sequence:CCGGCTTTGTTATGGAGAGGTTAATCTCGAGATTAACCTCTCCATAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022090.3-1029s21c1
Sequence:CCGGATGGCATTTGTGCGCTATATACTCGAGTATATAGCGCACAAATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-2258s1c1
Sequence:CCGGCCTCGTTTCTCGGACATCATTCTCGAGAATGATGTCCGAGAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-709s1c1
Sequence:CCGGGCATGATCTCAATAGCCTGAACTCGAGTTCAGGCTATTGAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-2041s1c1
Sequence:CCGGCCTAATGGAATTTGAGACAATCTCGAGATTGTCTCAAATTCCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-809s1c1
Sequence:CCGGGCATCGTATCAATTTGCGTATCTCGAGATACGCAAATTGATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022090.2-1848s1c1
Sequence:CCGGGCATATTCATTGCAGCTGAAACTCGAGTTTCAGCTGCAATGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022090.2-1937s1c1
Sequence:CCGGGCAAGTAAATGGATATTGGATCTCGAGATCCAATATCCATTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1319s1c1
Sequence:CCGGCCTCATATCGTAGTTACACATCTCGAGATGTGTAACTACGATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1442s1c1
Sequence:CCGGGCTCCAAATCATCGCCTATTTCTCGAGAAATAGGCGATGATTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-1159s1c1
Sequence:CCGGGCAGCTATCCATGAAAGGAATCTCGAGATTCCTTTCATGGATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022090.2-836s1c1
Sequence:CCGGGCCAAGGAGAAGAATCCTCATCTCGAGATGAGGATTCTTCTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022090.2-2293s1c1
Sequence:CCGGGCTACAGCAGAAGTCACTGTACTCGAGTACAGTGACTTCTGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks