EMAIL THIS PAGE TO A FRIEND

C5orf55

chromosome 5 open reading frame 55

25 Gene Product Result for
Species: Human C5orf55(116349)
UniProtKB ID: Q8N2X6, Q96CR9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138464 Rosetta Predictions human pricing
XM_931730 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363644 predicted 693
2 SASI_Hs02_00363645 predicted 394
3 SASI_Hs02_00363646 predicted 712
4 SASI_Hs02_00363647 predicted 682
5 SASI_Hs02_00363648 predicted 705
6 SASI_Hs02_00363649 predicted 817
7 SASI_Hs02_00363650 predicted 430
8 SASI_Hs02_00363651 predicted 394
9 SASI_Hs02_00363652 predicted 280
10 SASI_Hs02_00363653 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268876 predicted 133
2 SASI_Hs01_00268877 predicted 195
3 SASI_Hs01_00268878 predicted 158
4 SASI_Hs01_00268879 predicted 26
5 SASI_Hs01_00268880 predicted 120
6 SASI_Hs01_00268881 predicted 10
7 SASI_Hs01_00268882 predicted 135
8 SASI_Hs01_00268883 predicted 29
9 SASI_Hs01_00268884 predicted 40
10 SASI_Hs01_00268885 predicted 193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138464
C5orf55 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 55
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138464.2-1231s21c1
Sequence:CCGGGAACTAAAGACTCATACTATTCTCGAGAATAGTATGAGTCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-624s21c1
Sequence:CCGGGCAGGTCTTGGAGAATGAATGCTCGAGCATTCATTCTCCAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-502s21c1
Sequence:CCGGTCCTGGACCCAAAGACGAACTCTCGAGAGTTCGTCTTTGGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-411s21c1
Sequence:CCGGGCATTCAGTAAACGAAGAAACCTCGAGGTTTCTTCGTTTACTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138464
C5orf55 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 55
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138464.2-1231s21c1
Sequence:CCGGGAACTAAAGACTCATACTATTCTCGAGAATAGTATGAGTCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-624s21c1
Sequence:CCGGGCAGGTCTTGGAGAATGAATGCTCGAGCATTCATTCTCCAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-502s21c1
Sequence:CCGGTCCTGGACCCAAAGACGAACTCTCGAGAGTTCGTCTTTGGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-411s21c1
Sequence:CCGGGCATTCAGTAAACGAAGAAACCTCGAGGTTTCTTCGTTTACTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138464
C5orf55 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 55
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138464.2-1231s21c1
Sequence:CCGGGAACTAAAGACTCATACTATTCTCGAGAATAGTATGAGTCTTTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-624s21c1
Sequence:CCGGGCAGGTCTTGGAGAATGAATGCTCGAGCATTCATTCTCCAAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-502s21c1
Sequence:CCGGTCCTGGACCCAAAGACGAACTCTCGAGAGTTCGTCTTTGGGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138464.2-411s21c1
Sequence:CCGGGCATTCAGTAAACGAAGAAACCTCGAGGTTTCTTCGTTTACTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks