EMAIL THIS PAGE TO A FRIEND

C5orf56

chromosome 5 open reading frame 56

18 Gene Product Result for
Species: Human C5orf56(441108)
UniProtKB ID: Q8N8D9, A1L3V9, A6NKA0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134879 predicted 611
2 SASI_Hs01_00134880 predicted 840
3 SASI_Hs01_00134882 predicted 607
4 SASI_Hs01_00134884 predicted 799
5 SASI_Hs01_00134885 predicted 616
6 SASI_Hs01_00134886 predicted 176
7 SASI_Hs01_00134887 predicted 820
8 SASI_Hs02_00306481 predicted 319
9 SASI_Hs01_00134888 predicted 533
10 SASI_Hs02_00306482 predicted 575
11 SASI_Hs01_00134881 predicted 833
12 SASI_Hs01_00134883 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013717
C5orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 56
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013717.1-1296s1c1
Sequence:CCGGGCATTGCTATTGGGAACGTAACTCGAGTTACGTTCCCAATAGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-339s1c1
Sequence:CCGGCAGCCAAGATTCTGGAAAGAACTCGAGTTCTTTCCAGAATCTTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-385s1c1
Sequence:CCGGCCACTCATTTATTCAGCAAGTCTCGAGACTTGCTGAATAAATGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-184s1c1
Sequence:CCGGCAGAGTTTGTAGCCTATTGGACTCGAGTCCAATAGGCTACAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-350s1c1
Sequence:CCGGCTGGAAAGAAATGTCTCCTTTCTCGAGAAAGGAGACATTTCTTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013717
C5orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 56
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013717.1-1296s1c1
Sequence:CCGGGCATTGCTATTGGGAACGTAACTCGAGTTACGTTCCCAATAGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-339s1c1
Sequence:CCGGCAGCCAAGATTCTGGAAAGAACTCGAGTTCTTTCCAGAATCTTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-385s1c1
Sequence:CCGGCCACTCATTTATTCAGCAAGTCTCGAGACTTGCTGAATAAATGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-184s1c1
Sequence:CCGGCAGAGTTTGTAGCCTATTGGACTCGAGTCCAATAGGCTACAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-350s1c1
Sequence:CCGGCTGGAAAGAAATGTCTCCTTTCTCGAGAAAGGAGACATTTCTTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013717
C5orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 56
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013717.1-1296s1c1
Sequence:CCGGGCATTGCTATTGGGAACGTAACTCGAGTTACGTTCCCAATAGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-339s1c1
Sequence:CCGGCAGCCAAGATTCTGGAAAGAACTCGAGTTCTTTCCAGAATCTTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-385s1c1
Sequence:CCGGCCACTCATTTATTCAGCAAGTCTCGAGACTTGCTGAATAAATGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-184s1c1
Sequence:CCGGCAGAGTTTGTAGCCTATTGGACTCGAGTCCAATAGGCTACAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013717.1-350s1c1
Sequence:CCGGCTGGAAAGAAATGTCTCCTTTCTCGAGAAAGGAGACATTTCTTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)