EMAIL THIS PAGE TO A FRIEND

C5orf58

chromosome 5 open reading frame 58

Species: Human C5orf58(133874)
UniProtKB ID: C9J3I9
Gene ID:
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230951 MISSION® esiRNA esiRNA targeting human C5orf58 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102609 Rosetta Predictions human pricing
XM_059672 Rosetta Predictions human pricing
XM_931670 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323399 predicted 198
2 SASI_Hs02_00323400 predicted 219
3 SASI_Hs02_00323401 predicted 210
4 SASI_Hs02_00323402 predicted 243
5 SASI_Hs02_00323403 predicted 204
6 SASI_Hs02_00323404 predicted 213
7 SASI_Hs02_00323405 predicted 204
8 SASI_Hs02_00323406 predicted 235
9 SASI_Hs02_00323407 predicted 202
10 SASI_Hs02_00323408 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278046 predicted 236
2 SASI_Hs01_00278047 predicted 108
3 SASI_Hs01_00278048 predicted 105
4 SASI_Hs01_00278049 predicted 194
5 SASI_Hs01_00278050 predicted 118
6 SASI_Hs01_00278051 predicted 90
7 SASI_Hs01_00278052 predicted 93
8 SASI_Hs01_00278053 predicted 65
9 SASI_Hs01_00278054 predicted 149
10 SASI_Hs01_00278055 predicted 94
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300478 predicted 1188
2 SASI_Hs01_00300479 predicted 1212
3 SASI_Hs01_00300480 predicted 1163
4 SASI_Hs01_00300481 predicted 1131
5 SASI_Hs01_00300482 predicted 1166
6 SASI_Hs01_00300483 predicted 1246
7 SASI_Hs01_00300484 predicted 1161
8 SASI_Hs01_00300485 predicted 1179
9 SASI_Hs01_00300486 predicted 1184
10 SASI_Hs01_00300487 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102609
C5orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 58
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-124s21c1
Sequence:CCGGTAGAGGCAAGGATTGACTTAACTCGAGTTAAGTCAATCCTTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-260s21c1
Sequence:CCGGTTGTGACCTTATCCTACATTTCTCGAGAAATGTAGGATAAGGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-155s21c1
Sequence:CCGGGAAGCGTGTTACTGATCATAACTCGAGTTATGATCAGTAACACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-289s21c1
Sequence:CCGGCCATCAAGACTGAGAACTTAGCTCGAGCTAAGTTCTCAGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-177s21c1
Sequence:CCGGCTAAATGTGGACAAAGTAATTCTCGAGAATTACTTTGTCCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102609
C5orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 58
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-124s21c1
Sequence:CCGGTAGAGGCAAGGATTGACTTAACTCGAGTTAAGTCAATCCTTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-260s21c1
Sequence:CCGGTTGTGACCTTATCCTACATTTCTCGAGAAATGTAGGATAAGGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-155s21c1
Sequence:CCGGGAAGCGTGTTACTGATCATAACTCGAGTTATGATCAGTAACACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-289s21c1
Sequence:CCGGCCATCAAGACTGAGAACTTAGCTCGAGCTAAGTTCTCAGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-177s21c1
Sequence:CCGGCTAAATGTGGACAAAGTAATTCTCGAGAATTACTTTGTCCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102609
C5orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 58
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-124s21c1
Sequence:CCGGTAGAGGCAAGGATTGACTTAACTCGAGTTAAGTCAATCCTTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-260s21c1
Sequence:CCGGTTGTGACCTTATCCTACATTTCTCGAGAAATGTAGGATAAGGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-155s21c1
Sequence:CCGGGAAGCGTGTTACTGATCATAACTCGAGTTATGATCAGTAACACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-289s21c1
Sequence:CCGGCCATCAAGACTGAGAACTTAGCTCGAGCTAAGTTCTCAGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102609.1-177s21c1
Sequence:CCGGCTAAATGTGGACAAAGTAATTCTCGAGAATTACTTTGTCCACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks