EMAIL THIS PAGE TO A FRIEND

C5orf60

chromosome 5 open reading frame 60

42 Gene Product Result for
Species: Human C5orf60(285679)
UniProtKB ID: A6NFR6, A1L488, B7ZM52, B7ZM53
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001142306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721773 Rosetta Predictions human pricing
XM_001723967 Rosetta Predictions human pricing
XM_209719 Rosetta Predictions human pricing
XM_929175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444946 predicted 91
2 SASI_Hs02_00444947 predicted 270
3 SASI_Hs02_00444948 predicted 131
4 SASI_Hs02_00444949 predicted 194
5 SASI_Hs02_00444950 predicted 260
6 SASI_Hs02_00444951 predicted 170
7 SASI_Hs02_00444952 predicted 45
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00458707 predicted 237
2 SASI_Hs02_00458708 predicted 556
3 SASI_Hs02_00458709 predicted 300
4 SASI_Hs02_00458710 predicted 255
5 SASI_Hs02_00458711 predicted 397
6 SASI_Hs02_00458712 predicted 306
7 SASI_Hs02_00458713 predicted 407
8 SASI_Hs02_00458714 predicted 328
9 SASI_Hs02_00458715 predicted 269
10 SASI_Hs02_00458716 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251922 predicted 271
2 SASI_Hs01_00251923 predicted 85
3 SASI_Hs01_00251924 predicted 119
4 SASI_Hs01_00251925 predicted 744
5 SASI_Hs01_00251926 predicted 707
6 SASI_Hs01_00251927 predicted 29
7 SASI_Hs01_00251928 predicted 774
8 SASI_Hs01_00251929 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294825 predicted 260
2 SASI_Hs01_00294826 predicted 261
3 SASI_Hs01_00294827 predicted 252
4 SASI_Hs01_00294828 predicted 259
5 SASI_Hs01_00294829 predicted 291
6 SASI_Hs01_00294830 predicted 264
7 SASI_Hs01_00294831 predicted 101
8 SASI_Hs01_00294832 predicted 131
9 SASI_Hs01_00294833 predicted 1149
10 SASI_Hs01_00294834 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142306
C5orf60 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 60
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142306.1-1035s21c1
Sequence:CCGGTCGAGAGAAGGTGTCACCATGCTCGAGCATGGTGACACCTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-181s21c1
Sequence:CCGGTTATCTTACGCCTCTACATTCCTCGAGGAATGTAGAGGCGTAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-808s21c1
Sequence:CCGGACTCCCATGGACACCGAATATCTCGAGATATTCGGTGTCCATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-87s21c1
Sequence:CCGGCTGGACAGTGTTATTGGTACACTCGAGTGTACCAATAACACTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-770s21c1
Sequence:CCGGCAACGCTGCTGGACGCATAAGCTCGAGCTTATGCGTCCAGCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142306
C5orf60 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 60
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142306.1-1035s21c1
Sequence:CCGGTCGAGAGAAGGTGTCACCATGCTCGAGCATGGTGACACCTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-181s21c1
Sequence:CCGGTTATCTTACGCCTCTACATTCCTCGAGGAATGTAGAGGCGTAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-808s21c1
Sequence:CCGGACTCCCATGGACACCGAATATCTCGAGATATTCGGTGTCCATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-87s21c1
Sequence:CCGGCTGGACAGTGTTATTGGTACACTCGAGTGTACCAATAACACTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-770s21c1
Sequence:CCGGCAACGCTGCTGGACGCATAAGCTCGAGCTTATGCGTCCAGCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142306
C5orf60 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 60
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142306.1-1035s21c1
Sequence:CCGGTCGAGAGAAGGTGTCACCATGCTCGAGCATGGTGACACCTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-181s21c1
Sequence:CCGGTTATCTTACGCCTCTACATTCCTCGAGGAATGTAGAGGCGTAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-808s21c1
Sequence:CCGGACTCCCATGGACACCGAATATCTCGAGATATTCGGTGTCCATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-87s21c1
Sequence:CCGGCTGGACAGTGTTATTGGTACACTCGAGTGTACCAATAACACTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142306.1-770s21c1
Sequence:CCGGCAACGCTGCTGGACGCATAAGCTCGAGCTTATGCGTCCAGCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks