EMAIL THIS PAGE TO A FRIEND

C5orf63

chromosome 5 open reading frame 63

58 Gene Product Result for
Synonyms: YDR286C
Species: Human C5orf63(401207)
UniProtKB ID: A6NC05, G3V557
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043240 Anti-C5orf63 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722994 Rosetta Predictions human pricing
XM_376423 Rosetta Predictions human pricing
XM_928325 Rosetta Predictions human pricing
XM_932789 Rosetta Predictions human pricing
XM_943643 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452511 predicted 228
2 SASI_Hs02_00452512 predicted 315
3 SASI_Hs02_00452513 predicted 225
4 SASI_Hs02_00452514 predicted 322
5 SASI_Hs02_00452515 predicted 231
6 SASI_Hs02_00452516 predicted 314
7 SASI_Hs02_00452517 predicted 218
8 SASI_Hs02_00452518 predicted 212
9 SASI_Hs02_00452519 predicted 210
10 SASI_Hs02_00452520 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278739 predicted 1142
2 SASI_Hs01_00278740 predicted 785
3 SASI_Hs01_00278741 predicted 811
4 SASI_Hs01_00278742 predicted 1010
5 SASI_Hs01_00278743 predicted 739
6 SASI_Hs01_00278744 predicted 987
7 SASI_Hs01_00278745 predicted 623
8 SASI_Hs01_00278746 predicted 1015
9 SASI_Hs01_00278747 predicted 914
10 SASI_Hs01_00278748 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291255 predicted 225
2 SASI_Hs01_00291256 predicted 288
3 SASI_Hs01_00291257 predicted 281
4 SASI_Hs01_00291258 predicted 320
5 SASI_Hs01_00291259 predicted 208
6 SASI_Hs01_00291260 predicted 284
7 SASI_Hs01_00291261 predicted 221
8 SASI_Hs01_00291262 predicted 413
9 SASI_Hs01_00291263 predicted 316
10 SASI_Hs01_00291264 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287695 predicted 226
2 SASI_Hs01_00287699 predicted 315
3 SASI_Hs01_00287700 predicted 225
4 SASI_Hs02_00481578 predicted 314
5 SASI_Hs02_00481579 predicted 229
6 SASI_Hs02_00481580 predicted 315
7 SASI_Hs02_00481581 predicted 216
8 SASI_Hs02_00481582 predicted 211
9 SASI_Hs02_00481583 predicted 215
10 SASI_Hs02_00481584 predicted 217
11 SASI_Hs01_00287692 predicted 228
12 SASI_Hs01_00287693 predicted 288
13 SASI_Hs01_00287694 predicted 281
14 SASI_Hs01_00287696 predicted 200
15 SASI_Hs01_00287697 predicted 283
16 SASI_Hs01_00287698 predicted 220
17 SASI_Hs01_00287701 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_943643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486096 predicted 229
2 SASI_Hs02_00486097 predicted 314
3 SASI_Hs02_00486098 predicted 231
4 SASI_Hs02_00486099 predicted 320
5 SASI_Hs02_00486100 predicted 234
6 SASI_Hs02_00486101 predicted 306
7 SASI_Hs02_00486102 predicted 211
8 SASI_Hs02_00486103 predicted 210
9 SASI_Hs02_00486104 predicted 210
10 SASI_Hs02_00486105 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164478
C5orf63 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 63
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-294s21c1
Sequence:CCGGAGGAAGTACTCAAGCCTTATGCTCGAGCATAAGGCTTGAGTACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-421s21c1
Sequence:CCGGTCTGATGATGCATCGAGTAAACTCGAGTTTACTCGATGCATCATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-558s21c1
Sequence:CCGGACCATGGCCTGATACTCATTTCTCGAGAAATGAGTATCAGGCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-393s21c1
Sequence:CCGGTTCCTGTCTTTCACTTGAATGCTCGAGCATTCAAGTGAAAGACAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-519s21c1
Sequence:CCGGCCACCCTCTCTTCCCATAAAGCTCGAGCTTTATGGGAAGAGAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-497s21c1
Sequence:CCGGTGACTGATGCCCTCATGATTTCTCGAGAAATCATGAGGGCATCAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-245s21c1
Sequence:CCGGGTGTTGACCTTATTCACAAAGCTCGAGCTTTGTGAATAAGGTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-366s21c1
Sequence:CCGGTCTGGTATGAAAGGTATAAATCTCGAGATTTATACCTTTCATACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164478
C5orf63 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 63
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-294s21c1
Sequence:CCGGAGGAAGTACTCAAGCCTTATGCTCGAGCATAAGGCTTGAGTACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-421s21c1
Sequence:CCGGTCTGATGATGCATCGAGTAAACTCGAGTTTACTCGATGCATCATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-558s21c1
Sequence:CCGGACCATGGCCTGATACTCATTTCTCGAGAAATGAGTATCAGGCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-393s21c1
Sequence:CCGGTTCCTGTCTTTCACTTGAATGCTCGAGCATTCAAGTGAAAGACAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-519s21c1
Sequence:CCGGCCACCCTCTCTTCCCATAAAGCTCGAGCTTTATGGGAAGAGAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-497s21c1
Sequence:CCGGTGACTGATGCCCTCATGATTTCTCGAGAAATCATGAGGGCATCAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-245s21c1
Sequence:CCGGGTGTTGACCTTATTCACAAAGCTCGAGCTTTGTGAATAAGGTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-366s21c1
Sequence:CCGGTCTGGTATGAAAGGTATAAATCTCGAGATTTATACCTTTCATACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164478
C5orf63 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 63
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-294s21c1
Sequence:CCGGAGGAAGTACTCAAGCCTTATGCTCGAGCATAAGGCTTGAGTACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-421s21c1
Sequence:CCGGTCTGATGATGCATCGAGTAAACTCGAGTTTACTCGATGCATCATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-558s21c1
Sequence:CCGGACCATGGCCTGATACTCATTTCTCGAGAAATGAGTATCAGGCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-393s21c1
Sequence:CCGGTTCCTGTCTTTCACTTGAATGCTCGAGCATTCAAGTGAAAGACAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164478.1-519s21c1
Sequence:CCGGCCACCCTCTCTTCCCATAAAGCTCGAGCTTTATGGGAAGAGAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-497s21c1
Sequence:CCGGTGACTGATGCCCTCATGATTTCTCGAGAAATCATGAGGGCATCAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-245s21c1
Sequence:CCGGGTGTTGACCTTATTCACAAAGCTCGAGCTTTGTGAATAAGGTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164478.1-366s21c1
Sequence:CCGGTCTGGTATGAAAGGTATAAATCTCGAGATTTATACCTTTCATACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)