EMAIL THIS PAGE TO A FRIEND

C5orf64

chromosome 5 open reading frame 64

Species: Human C5orf64(285668)
UniProtKB ID: Q2M2E5, Q2M2H1, Q8N1U8
Gene ID:
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067842 predicted 550
2 SASI_Hs01_00067834 predicted 456
3 SASI_Hs01_00067836 predicted 379
4 SASI_Hs01_00067837 predicted 387
5 SASI_Hs01_00067838 predicted 485
6 SASI_Hs01_00067839 predicted 398
7 SASI_Hs01_00067841 predicted 497
8 SASI_Hs01_00067843 predicted 340
9 SASI_Hs02_00368596 predicted 333
10 SASI_Hs02_00368597 predicted 528
11 SASI_Hs01_00067835 predicted 364
12 SASI_Hs01_00067840 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173667
C5orf64 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 64
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-244s1c1
Sequence:CCGGGCTGAAGTTTACTTCCCTTCACTCGAGTGAAGGGAAGTAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-360s1c1
Sequence:CCGGGAGACAAATAGAGGAACGGAACTCGAGTTCCGTTCCTCTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-585s1c1
Sequence:CCGGGCAAGGTAATCAAGTCCATAACTCGAGTTATGGACTTGATTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-196s1c1
Sequence:CCGGGAGACAGAGTTCAAGCAGAATCTCGAGATTCTGCTTGAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-355s1c1
Sequence:CCGGGCAGAGAGACAAATAGAGGAACTCGAGTTCCTCTATTTGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-259s1c1
Sequence:CCGGCCTTCAATCAAATCGAGATCACTCGAGTGATCTCGATTTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-1900s1c1
Sequence:CCGGGCAGCTTCTATACTTGACATACTCGAGTATGTCAAGTATAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-411s1c1
Sequence:CCGGGTTAGCTGACTGTGTTCTAAACTCGAGTTTAGAACACAGTCAGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-140s1c1
Sequence:CCGGCTCCTCAATTAGGCAGAACAACTCGAGTTGTTCTGCCTAATTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-275s1c1
Sequence:CCGGGATCACATCTTCCTGCAGTTTCTCGAGAAACTGCAGGAAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173667
C5orf64 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 64
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-244s1c1
Sequence:CCGGGCTGAAGTTTACTTCCCTTCACTCGAGTGAAGGGAAGTAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-360s1c1
Sequence:CCGGGAGACAAATAGAGGAACGGAACTCGAGTTCCGTTCCTCTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-585s1c1
Sequence:CCGGGCAAGGTAATCAAGTCCATAACTCGAGTTATGGACTTGATTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-196s1c1
Sequence:CCGGGAGACAGAGTTCAAGCAGAATCTCGAGATTCTGCTTGAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-355s1c1
Sequence:CCGGGCAGAGAGACAAATAGAGGAACTCGAGTTCCTCTATTTGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-259s1c1
Sequence:CCGGCCTTCAATCAAATCGAGATCACTCGAGTGATCTCGATTTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-1900s1c1
Sequence:CCGGGCAGCTTCTATACTTGACATACTCGAGTATGTCAAGTATAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-411s1c1
Sequence:CCGGGTTAGCTGACTGTGTTCTAAACTCGAGTTTAGAACACAGTCAGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-140s1c1
Sequence:CCGGCTCCTCAATTAGGCAGAACAACTCGAGTTGTTCTGCCTAATTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-275s1c1
Sequence:CCGGGATCACATCTTCCTGCAGTTTCTCGAGAAACTGCAGGAAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173667
C5orf64 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 64
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-244s1c1
Sequence:CCGGGCTGAAGTTTACTTCCCTTCACTCGAGTGAAGGGAAGTAAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-360s1c1
Sequence:CCGGGAGACAAATAGAGGAACGGAACTCGAGTTCCGTTCCTCTATTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-585s1c1
Sequence:CCGGGCAAGGTAATCAAGTCCATAACTCGAGTTATGGACTTGATTACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-196s1c1
Sequence:CCGGGAGACAGAGTTCAAGCAGAATCTCGAGATTCTGCTTGAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-355s1c1
Sequence:CCGGGCAGAGAGACAAATAGAGGAACTCGAGTTCCTCTATTTGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-259s1c1
Sequence:CCGGCCTTCAATCAAATCGAGATCACTCGAGTGATCTCGATTTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173667.1-1900s1c1
Sequence:CCGGGCAGCTTCTATACTTGACATACTCGAGTATGTCAAGTATAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-411s1c1
Sequence:CCGGGTTAGCTGACTGTGTTCTAAACTCGAGTTTAGAACACAGTCAGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173667.1-140s1c1
Sequence:CCGGCTCCTCAATTAGGCAGAACAACTCGAGTTGTTCTGCCTAATTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173667.1-275s1c1
Sequence:CCGGGATCACATCTTCCTGCAGTTTCTCGAGAAACTGCAGGAAGATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks