EMAIL THIS PAGE TO A FRIEND

C6

complement component 6

100 Gene Product Result for
UniProtKB ID: P13671
Gene ID:
Human(729) Summary: This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
Mouse(12274) complement component 6
Rat(24237) complement component 6
Zebrafish(393611) complement component 6
cow(507749) complement component 6
chicken(431585) complement component 6
domestic cat(101095155) complement component 6
dog(479348) complement component 6
sheep(101102674) complement component 6
Domestic Rabbit(100359210) complement component 6
naked mole-rat(101719948) complement component 6
domestic guinea pig(100733974) complement component 6
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0488 AQUA Peptide DLHLSDVFL[K] human pricing
AQ0487 AQUA Peptide HEGSFIQGAE[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000065 Rosetta Predictions human pricing
NM_001115131 Rosetta Predictions human pricing
NM_176074 Rosetta Predictions rat pricing
NM_016704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188281 predicted 1321
2 SASI_Hs02_00301784 predicted 1534
3 SASI_Hs01_00188282 predicted 2349
4 SASI_Hs01_00188283 predicted 2942
5 SASI_Hs01_00188284 predicted 2747
6 SASI_Hs02_00301785 predicted 2120
7 SASI_Hs01_00188285 predicted 1184
8 SASI_Hs01_00188287 predicted 738
9 SASI_Hs02_00301786 predicted 2611
10 SASI_Hs01_00188289 predicted 2521
11 SASI_Hs01_00188286 predicted 1306
12 SASI_Hs01_00188288 predicted 719
13 SASI_Hs01_00188290 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326966 predicted 1378
2 SASI_Hs02_00326967 predicted 1589
3 SASI_Hs02_00326968 predicted 2405
4 SASI_Hs02_00326969 predicted 2991
5 SASI_Hs02_00326970 predicted 2798
6 SASI_Hs02_00326971 predicted 2177
7 SASI_Hs02_00326972 predicted 1232
8 SASI_Hs02_00326973 predicted 787
9 SASI_Hs02_00326974 predicted 2667
10 SASI_Hs02_00326975 predicted 2573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269555 predicted 903
2 SASI_Rn01_00085972 predicted 2391
3 SASI_Rn01_00085973 predicted 1187
4 SASI_Rn01_00085974 predicted 2262
5 SASI_Rn01_00085975 predicted 1157
6 SASI_Rn01_00085976 predicted 2402
7 SASI_Rn01_00085977 predicted 531
8 SASI_Rn01_00085978 predicted 1559
9 SASI_Rn02_00269556 predicted 1550
10 SASI_Rn01_00085979 predicted 2363
11 SASI_Rn01_00085980 predicted 1085
12 SASI_Rn01_00085981 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194389 predicted 1855
2 SASI_Mm01_00194390 predicted 2407
3 SASI_Mm01_00194391 predicted 572
4 SASI_Mm01_00194393 predicted 2463
5 SASI_Mm01_00194394 predicted 1276
6 SASI_Mm02_00323375 predicted 666
7 SASI_Mm01_00194395 predicted 2218
8 SASI_Mm01_00194396 predicted 2169
9 SASI_Mm01_00194397 predicted 269
10 SASI_Mm01_00194398 predicted 1246
11 SASI_Mm01_00194392 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016704
C6 MISSION shRNA Bacterial Glycerol Stock
complement component 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-586s1c1
Sequence:CCGGCCCAGCAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-806s1c1
Sequence:CCGGCCAGTAATCCATACCGTGTTTCTCGAGAAACACGGTATGGATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-2333s1c1
Sequence:CCGGGCTTTGTTGTTGCTGGACCATCTCGAGATGGTCCAGCAACAACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1021s1c1
Sequence:CCGGGCCTTCAACAAAGTCATTAAACTCGAGTTTAATGACTTTGTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1993s1c1
Sequence:CCGGCCATGTATCAATGATGATGAACTCGAGTTCATCATCATTGATACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016704
C6 MISSION shRNA shRNA Plasmid DNA
complement component 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-586s1c1
Sequence:CCGGCCCAGCAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-806s1c1
Sequence:CCGGCCAGTAATCCATACCGTGTTTCTCGAGAAACACGGTATGGATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-2333s1c1
Sequence:CCGGGCTTTGTTGTTGCTGGACCATCTCGAGATGGTCCAGCAACAACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1021s1c1
Sequence:CCGGGCCTTCAACAAAGTCATTAAACTCGAGTTTAATGACTTTGTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1993s1c1
Sequence:CCGGCCATGTATCAATGATGATGAACTCGAGTTCATCATCATTGATACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016704
C6 MISSION shRNA Lentiviral Transduction Particles
complement component 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-586s1c1
Sequence:CCGGCCCAGCAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-806s1c1
Sequence:CCGGCCAGTAATCCATACCGTGTTTCTCGAGAAACACGGTATGGATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-2333s1c1
Sequence:CCGGGCTTTGTTGTTGCTGGACCATCTCGAGATGGTCCAGCAACAACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1021s1c1
Sequence:CCGGGCCTTCAACAAAGTCATTAAACTCGAGTTTAATGACTTTGTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016704.1-1993s1c1
Sequence:CCGGCCATGTATCAATGATGATGAACTCGAGTTCATCATCATTGATACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000065
C6 MISSION shRNA Bacterial Glycerol Stock
complement component 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-766s1c1
Sequence:CCGGCCAGAGGAGAAGTCCTTGATACTCGAGTATCAAGGACTTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2167s1c1
Sequence:CCGGCATGCCTTACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTAAGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-612s1c1
Sequence:CCGGGCCAGAAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-1176s1c1
Sequence:CCGGGCACTTAACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2785s1c1
Sequence:CCGGCTTCCAAATGTGTCTGCCTATCTCGAGATAGGCAGACACATTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000065.2-1263s21c1
Sequence:CCGGTGCTTTGTACAGCCGAATATTCTCGAGAATATTCGGCTGTACAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000065.2-3322s21c1
Sequence:CCGGCATTAAGCATTCTCGCAATTACTCGAGTAATTGCGAGAATGCTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000065
C6 MISSION shRNA shRNA Plasmid DNA
complement component 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-766s1c1
Sequence:CCGGCCAGAGGAGAAGTCCTTGATACTCGAGTATCAAGGACTTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2167s1c1
Sequence:CCGGCATGCCTTACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTAAGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-612s1c1
Sequence:CCGGGCCAGAAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-1176s1c1
Sequence:CCGGGCACTTAACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2785s1c1
Sequence:CCGGCTTCCAAATGTGTCTGCCTATCTCGAGATAGGCAGACACATTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000065.2-1263s21c1
Sequence:CCGGTGCTTTGTACAGCCGAATATTCTCGAGAATATTCGGCTGTACAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000065.2-3322s21c1
Sequence:CCGGCATTAAGCATTCTCGCAATTACTCGAGTAATTGCGAGAATGCTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000065
C6 MISSION shRNA Lentiviral Transduction Particles
complement component 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-766s1c1
Sequence:CCGGCCAGAGGAGAAGTCCTTGATACTCGAGTATCAAGGACTTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2167s1c1
Sequence:CCGGCATGCCTTACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTAAGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-612s1c1
Sequence:CCGGGCCAGAAAGTTAGAATGCAATCTCGAGATTGCATTCTAACTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-1176s1c1
Sequence:CCGGGCACTTAACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000065.1-2785s1c1
Sequence:CCGGCTTCCAAATGTGTCTGCCTATCTCGAGATAGGCAGACACATTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000065.2-1263s21c1
Sequence:CCGGTGCTTTGTACAGCCGAATATTCTCGAGAATATTCGGCTGTACAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000065.2-3322s21c1
Sequence:CCGGCATTAAGCATTCTCGCAATTACTCGAGTAATTGCGAGAATGCTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)