EMAIL THIS PAGE TO A FRIEND

C6orf106

chromosome 6 open reading frame 106

Synonyms: FP852 dJ391O22.4
Species: Human C6orf106(64771)
UniProtKB ID: Q9H6K1, B2R8K7, Q5VV77, Q96MG5, Q9BUR9
Gene ID:
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024294 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094101 MISSION® esiRNA esiRNA human C6orf106 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022758 Rosetta Predictions human pricing
NM_024294 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029388 predicted 876
2 SASI_Hs01_00029389 predicted 937
3 SASI_Hs02_00356021 predicted 868
4 SASI_Hs01_00029390 predicted 559
5 SASI_Hs01_00029391 predicted 1108
6 SASI_Hs01_00029392 predicted 408
7 SASI_Hs01_00029394 predicted 1116
8 SASI_Hs01_00029395 predicted 1146
9 SASI_Hs01_00029396 predicted 1210
10 SASI_Hs01_00029397 predicted 506
11 SASI_Hs01_00029393 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037209 predicted 1077
2 SASI_Hs01_00037210 predicted 1133
3 SASI_Hs02_00356626 predicted 1067
4 SASI_Hs01_00037211 predicted 1308
5 SASI_Hs01_00037212 predicted 756
6 SASI_Hs01_00037213 predicted 408
7 SASI_Hs01_00037216 predicted 1315
8 SASI_Hs01_00037217 predicted 1344
9 SASI_Hs01_00037218 predicted 503
10 SASI_Hs02_00356627 predicted 1405
11 SASI_Hs01_00037214 predicted 865
12 SASI_Hs01_00037215 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024294
VALIDATED
C6orf106 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 106
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-1071s1c1
Sequence:CCGGCACGCAAACAACTTATCAGTACTCGAGTACTGATAAGTTGTTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-473s1c1
Sequence:CCGGCTTTGTTGAAGATGTCACCATCTCGAGATGGTGACATCTTCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-1732s1c1
Sequence:CCGGGCCAATGAGTTATCACCCTTTCTCGAGAAAGGGTGATAACTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-1020s1c1
Sequence:CCGGCAAGACCAGAATAGACTGTCACTCGAGTGACAGTCTATTCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-700s1c1
Sequence:CCGGCAGGAATGTATCAGGGACAGTCTCGAGACTGTCCCTGATACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-652s1c1
Sequence:CCGGCCCAAGAGATTGCAGATGTCACTCGAGTGACATCTGCAATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-945s1c1
Sequence:CCGGGAGTTCGACTCGATCAGCAAACTCGAGTTTGCTGATCGAGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-414s21c1
Sequence:CCGGGCAGCAATTGGCGCCTATTATCTCGAGATAATAGGCGCCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-1139s21c1
Sequence:CCGGTTAAACGGGTGTCAGCAAGAACTCGAGTTCTTGCTGACACCCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-605s21c1
Sequence:CCGGAGACCAATTTGGACATGTGAACTCGAGTTCACATGTCCAAATTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024294.2-1402s21c1
Sequence:CCGGCATCAGTCTAACAAGTCATTACTCGAGTAATGACTTGTTAGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-802s21c1
Sequence:CCGGGAGTAACGCAGCAGCTGTCATCTCGAGATGACAGCTGCTGCGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-515s21c1
Sequence:CCGGTCCGGATACTCAGTTTGTAAACTCGAGTTTACAAACTGAGTATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-898s21c1
Sequence:CCGGAGAACCGACAATCAGATGAAACTCGAGTTTCATCTGATTGTCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024294
VALIDATED
C6orf106 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 106
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-1071s1c1
Sequence:CCGGCACGCAAACAACTTATCAGTACTCGAGTACTGATAAGTTGTTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-473s1c1
Sequence:CCGGCTTTGTTGAAGATGTCACCATCTCGAGATGGTGACATCTTCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-1732s1c1
Sequence:CCGGGCCAATGAGTTATCACCCTTTCTCGAGAAAGGGTGATAACTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-1020s1c1
Sequence:CCGGCAAGACCAGAATAGACTGTCACTCGAGTGACAGTCTATTCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-700s1c1
Sequence:CCGGCAGGAATGTATCAGGGACAGTCTCGAGACTGTCCCTGATACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-652s1c1
Sequence:CCGGCCCAAGAGATTGCAGATGTCACTCGAGTGACATCTGCAATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-945s1c1
Sequence:CCGGGAGTTCGACTCGATCAGCAAACTCGAGTTTGCTGATCGAGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-414s21c1
Sequence:CCGGGCAGCAATTGGCGCCTATTATCTCGAGATAATAGGCGCCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-1139s21c1
Sequence:CCGGTTAAACGGGTGTCAGCAAGAACTCGAGTTCTTGCTGACACCCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-605s21c1
Sequence:CCGGAGACCAATTTGGACATGTGAACTCGAGTTCACATGTCCAAATTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024294.2-1402s21c1
Sequence:CCGGCATCAGTCTAACAAGTCATTACTCGAGTAATGACTTGTTAGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-802s21c1
Sequence:CCGGGAGTAACGCAGCAGCTGTCATCTCGAGATGACAGCTGCTGCGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-515s21c1
Sequence:CCGGTCCGGATACTCAGTTTGTAAACTCGAGTTTACAAACTGAGTATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-898s21c1
Sequence:CCGGAGAACCGACAATCAGATGAAACTCGAGTTTCATCTGATTGTCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024294
VALIDATED
C6orf106 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 106
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-1071s1c1
Sequence:CCGGCACGCAAACAACTTATCAGTACTCGAGTACTGATAAGTTGTTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-473s1c1
Sequence:CCGGCTTTGTTGAAGATGTCACCATCTCGAGATGGTGACATCTTCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-1732s1c1
Sequence:CCGGGCCAATGAGTTATCACCCTTTCTCGAGAAAGGGTGATAACTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-1020s1c1
Sequence:CCGGCAAGACCAGAATAGACTGTCACTCGAGTGACAGTCTATTCTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024294.2-700s1c1
Sequence:CCGGCAGGAATGTATCAGGGACAGTCTCGAGACTGTCCCTGATACATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024294.2-652s1c1
Sequence:CCGGCCCAAGAGATTGCAGATGTCACTCGAGTGACATCTGCAATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024294.2-945s1c1
Sequence:CCGGGAGTTCGACTCGATCAGCAAACTCGAGTTTGCTGATCGAGTCGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-414s21c1
Sequence:CCGGGCAGCAATTGGCGCCTATTATCTCGAGATAATAGGCGCCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-1139s21c1
Sequence:CCGGTTAAACGGGTGTCAGCAAGAACTCGAGTTCTTGCTGACACCCGTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-605s21c1
Sequence:CCGGAGACCAATTTGGACATGTGAACTCGAGTTCACATGTCCAAATTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024294.2-1402s21c1
Sequence:CCGGCATCAGTCTAACAAGTCATTACTCGAGTAATGACTTGTTAGACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-802s21c1
Sequence:CCGGGAGTAACGCAGCAGCTGTCATCTCGAGATGACAGCTGCTGCGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-515s21c1
Sequence:CCGGTCCGGATACTCAGTTTGTAAACTCGAGTTTACAAACTGAGTATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024294.2-898s21c1
Sequence:CCGGAGAACCGACAATCAGATGAAACTCGAGTTTCATCTGATTGTCGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks