EMAIL THIS PAGE TO A FRIEND

C6orf10

chromosome 6 open reading frame 10

28 Gene Product Result for
Synonyms: TSBP
Species: Human C6orf10(10665)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105678 Anti-C6ORF10 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006781 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224311 MISSION® esiRNA esiRNA targeting human C6orf10 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006781 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342294 predicted 353
2 SASI_Hs01_00225264 predicted 949
3 SASI_Hs01_00225265 predicted 803
4 SASI_Hs01_00225266 predicted 511
5 SASI_Hs01_00225267 predicted 939
6 SASI_Hs01_00225268 predicted 1101
7 SASI_Hs01_00225269 predicted 918
8 SASI_Hs01_00225271 predicted 965
9 SASI_Hs02_00342295 predicted 888
10 SASI_Hs01_00225273 predicted 315
11 SASI_Hs01_00225270 predicted 545
12 SASI_Hs01_00225272 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006781
C6orf10 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1919s1c1
Sequence:CCGGCCAGATACAAACCATATCCCACTCGAGTGGGATATGGTTTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-1373s1c1
Sequence:CCGGGAGGGAGTCAGTTGTACTGAACTCGAGTTCAGTACAACTGACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-1226s1c1
Sequence:CCGGCCAAGTAACGAAGAGTGGGTTCTCGAGAACCCACTCTTCGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1937s1c1
Sequence:CCGGCCAGCCATTGCCTAAACAGATCTCGAGATCTGTTTAGGCAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-2033s1c1
Sequence:CCGGGCCACAAACCTCAGTTTCCAACTCGAGTTGGAAACTGAGGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-1883s1c1
Sequence:CCGGGCCCATAAGACAAGTGATTATCTCGAGATAATCACTTGTCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-927s1c1
Sequence:CCGGGCACTAAAGAATGACATCATACTCGAGTATGATGTCATTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-754s1c1
Sequence:CCGGGAATACCTCAAGTTCACACTACTCGAGTAGTGTGAACTTGAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-345s1c1
Sequence:CCGGCGACATGCATATTCAACACAACTCGAGTTGTGTTGAATATGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006781
C6orf10 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1919s1c1
Sequence:CCGGCCAGATACAAACCATATCCCACTCGAGTGGGATATGGTTTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-1373s1c1
Sequence:CCGGGAGGGAGTCAGTTGTACTGAACTCGAGTTCAGTACAACTGACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-1226s1c1
Sequence:CCGGCCAAGTAACGAAGAGTGGGTTCTCGAGAACCCACTCTTCGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1937s1c1
Sequence:CCGGCCAGCCATTGCCTAAACAGATCTCGAGATCTGTTTAGGCAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-2033s1c1
Sequence:CCGGGCCACAAACCTCAGTTTCCAACTCGAGTTGGAAACTGAGGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-1883s1c1
Sequence:CCGGGCCCATAAGACAAGTGATTATCTCGAGATAATCACTTGTCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-927s1c1
Sequence:CCGGGCACTAAAGAATGACATCATACTCGAGTATGATGTCATTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-754s1c1
Sequence:CCGGGAATACCTCAAGTTCACACTACTCGAGTAGTGTGAACTTGAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-345s1c1
Sequence:CCGGCGACATGCATATTCAACACAACTCGAGTTGTGTTGAATATGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006781
C6orf10 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1919s1c1
Sequence:CCGGCCAGATACAAACCATATCCCACTCGAGTGGGATATGGTTTGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-1373s1c1
Sequence:CCGGGAGGGAGTCAGTTGTACTGAACTCGAGTTCAGTACAACTGACTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-1226s1c1
Sequence:CCGGCCAAGTAACGAAGAGTGGGTTCTCGAGAACCCACTCTTCGTTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006781.2-1937s1c1
Sequence:CCGGCCAGCCATTGCCTAAACAGATCTCGAGATCTGTTTAGGCAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-2033s1c1
Sequence:CCGGGCCACAAACCTCAGTTTCCAACTCGAGTTGGAAACTGAGGTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006781.2-1883s1c1
Sequence:CCGGGCCCATAAGACAAGTGATTATCTCGAGATAATCACTTGTCTTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-927s1c1
Sequence:CCGGGCACTAAAGAATGACATCATACTCGAGTATGATGTCATTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006781.2-754s1c1
Sequence:CCGGGAATACCTCAAGTTCACACTACTCGAGTAGTGTGAACTTGAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006781.2-345s1c1
Sequence:CCGGCGACATGCATATTCAACACAACTCGAGTTGTGTTGAATATGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks