EMAIL THIS PAGE TO A FRIEND

C6orf118

chromosome 6 open reading frame 118

53 Gene Product Result for
Synonyms: bA85G2.1 dJ416F21.2
Species: Human C6orf118(168090)
UniProtKB ID: Q5T5N4, Q8TC11
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012401 MISSION® esiRNA esiRNA targeting human C6orf118 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144980 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172083 predicted 679
2 SASI_Hs01_00172084 predicted 1482
3 SASI_Hs01_00172085 predicted 856
4 SASI_Hs01_00172086 predicted 1149
5 SASI_Hs01_00172087 predicted 1246
6 SASI_Hs01_00172088 predicted 1510
7 SASI_Hs02_00364784 predicted 710
8 SASI_Hs01_00172089 predicted 1481
9 SASI_Hs01_00172090 predicted 1423
10 SASI_Hs01_00172091 predicted 1024
11 SASI_Hs01_00172092 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144980
C6orf118 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 118
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144980.3-1514s21c1
Sequence:CCGGCAGATGCATATACATTCATAACTCGAGTTATGAATGTATATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144980.1-1456s1c1
Sequence:CCGGGCCAGTGGAAATTCTTAACTTCTCGAGAAGTTAAGAATTTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1270s1c1
Sequence:CCGGCTTTGGTTCATACTGGAATTTCTCGAGAAATTCCAGTATGAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-665s1c1
Sequence:CCGGGTACAGGATGTTCCTGCGTTTCTCGAGAAACGCAGGAACATCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1175s1c1
Sequence:CCGGCCAACTTACTCTTACTGAGAACTCGAGTTCTCAGTAAGAGTAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-135s1c1
Sequence:CCGGCTGTGTAATCTGAAGAAACTTCTCGAGAAGTTTCTTCAGATTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144980
C6orf118 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 118
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144980.3-1514s21c1
Sequence:CCGGCAGATGCATATACATTCATAACTCGAGTTATGAATGTATATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144980.1-1456s1c1
Sequence:CCGGGCCAGTGGAAATTCTTAACTTCTCGAGAAGTTAAGAATTTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1270s1c1
Sequence:CCGGCTTTGGTTCATACTGGAATTTCTCGAGAAATTCCAGTATGAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-665s1c1
Sequence:CCGGGTACAGGATGTTCCTGCGTTTCTCGAGAAACGCAGGAACATCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1175s1c1
Sequence:CCGGCCAACTTACTCTTACTGAGAACTCGAGTTCTCAGTAAGAGTAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-135s1c1
Sequence:CCGGCTGTGTAATCTGAAGAAACTTCTCGAGAAGTTTCTTCAGATTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144980
C6orf118 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 118
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144980.3-1514s21c1
Sequence:CCGGCAGATGCATATACATTCATAACTCGAGTTATGAATGTATATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144980.1-1456s1c1
Sequence:CCGGGCCAGTGGAAATTCTTAACTTCTCGAGAAGTTAAGAATTTCCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1270s1c1
Sequence:CCGGCTTTGGTTCATACTGGAATTTCTCGAGAAATTCCAGTATGAACCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-665s1c1
Sequence:CCGGGTACAGGATGTTCCTGCGTTTCTCGAGAAACGCAGGAACATCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-1175s1c1
Sequence:CCGGCCAACTTACTCTTACTGAGAACTCGAGTTCTCAGTAAGAGTAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144980.1-135s1c1
Sequence:CCGGCTGTGTAATCTGAAGAAACTTCTCGAGAAGTTTCTTCAGATTACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks