EMAIL THIS PAGE TO A FRIEND

C6orf120

chromosome 6 open reading frame 120

97 Gene Product Result for
Synonyms: bA160E12.4
Species: Human C6orf120(387263)
UniProtKB ID: Q7Z4R8, B4DHE9, E1P5C9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045851 MISSION® esiRNA esiRNA human C6orf120 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029863 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181694 predicted 439
2 SASI_Hs01_00181695 predicted 804
3 SASI_Hs02_00307540 predicted 432
4 SASI_Hs01_00181696 predicted 470
5 SASI_Hs01_00181697 predicted 1230
6 SASI_Hs01_00181699 predicted 486
7 SASI_Hs01_00181700 predicted 503
8 SASI_Hs01_00181701 predicted 931
9 SASI_Hs02_00307541 predicted 816
10 SASI_Hs02_00307542 predicted 974
11 SASI_Hs01_00181692 predicted 1153
12 SASI_Hs01_00181693 predicted 960
13 SASI_Hs01_00181698 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029863
VALIDATED
C6orf120 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 120
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029863.1-813s1c1
Sequence:CCGGGAATCTGTTCTCTGGACGATACTCGAGTATCGTCCAGAGAACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029863.1-3500s1c1
Sequence:CCGGCCTTTCTTGTTGGACTCCTTACTCGAGTAAGGAGTCCAACAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-565s21c1
Sequence:CCGGTCGACGACTACGAGCTGCAATCTCGAGATTGCAGCTCGTAGTCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-816s21c1
Sequence:CCGGTCTGTTCTCTGGACGATATTACTCGAGTAATATCGTCCAGAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-683s21c1
Sequence:CCGGGTTCGAGATGAAGGTGTACTACTCGAGTAGTACACCTTCATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-2441s21c1
Sequence:CCGGACTTCGTTGTAGGCATATATTCTCGAGAATATATGCCTACAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-475s21c1
Sequence:CCGGTGAACCACGAGGGCAAGATAGCTCGAGCTATCTTGCCCTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029863
VALIDATED
C6orf120 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 120
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029863.1-813s1c1
Sequence:CCGGGAATCTGTTCTCTGGACGATACTCGAGTATCGTCCAGAGAACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029863.1-3500s1c1
Sequence:CCGGCCTTTCTTGTTGGACTCCTTACTCGAGTAAGGAGTCCAACAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-565s21c1
Sequence:CCGGTCGACGACTACGAGCTGCAATCTCGAGATTGCAGCTCGTAGTCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-816s21c1
Sequence:CCGGTCTGTTCTCTGGACGATATTACTCGAGTAATATCGTCCAGAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-683s21c1
Sequence:CCGGGTTCGAGATGAAGGTGTACTACTCGAGTAGTACACCTTCATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-2441s21c1
Sequence:CCGGACTTCGTTGTAGGCATATATTCTCGAGAATATATGCCTACAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-475s21c1
Sequence:CCGGTGAACCACGAGGGCAAGATAGCTCGAGCTATCTTGCCCTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029863
VALIDATED
C6orf120 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 120
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029863.1-813s1c1
Sequence:CCGGGAATCTGTTCTCTGGACGATACTCGAGTATCGTCCAGAGAACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029863.1-3500s1c1
Sequence:CCGGCCTTTCTTGTTGGACTCCTTACTCGAGTAAGGAGTCCAACAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-565s21c1
Sequence:CCGGTCGACGACTACGAGCTGCAATCTCGAGATTGCAGCTCGTAGTCGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-816s21c1
Sequence:CCGGTCTGTTCTCTGGACGATATTACTCGAGTAATATCGTCCAGAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-683s21c1
Sequence:CCGGGTTCGAGATGAAGGTGTACTACTCGAGTAGTACACCTTCATCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001029863.1-2441s21c1
Sequence:CCGGACTTCGTTGTAGGCATATATTCTCGAGAATATATGCCTACAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029863.1-475s21c1
Sequence:CCGGTGAACCACGAGGGCAAGATAGCTCGAGCTATCTTGCCCTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks