EMAIL THIS PAGE TO A FRIEND

C6orf123

chromosome 6 open reading frame 123

43 Gene Product Result for
Synonyms: HGC6.2 RP3-431P23.4 dJ431P23.4
Species: Human C6orf123(26238)
UniProtKB ID: Q9Y6Z2, E1P5C8, Q5TIG8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014356 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014356 Rosetta Predictions human pricing
XR_039813 Rosetta Predictions human pricing
XR_039814 Rosetta Predictions human pricing
XR_039815 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182920 predicted 343
2 SASI_Hs01_00182921 predicted 410
3 SASI_Hs01_00182922 predicted 326
4 SASI_Hs01_00182923 predicted 446
5 SASI_Hs01_00182924 predicted 388
6 SASI_Hs01_00182925 predicted 486
7 SASI_Hs01_00182926 predicted 381
8 SASI_Hs01_00182927 predicted 370
9 SASI_Hs01_00182928 predicted 352
10 SASI_Hs01_00182929 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513342 predicted 50
2 SASI_Hs02_00513343 predicted 118
3 SASI_Hs02_00513344 predicted 119
4 SASI_Hs02_00513345 predicted 91
5 SASI_Hs02_00513346 predicted 52
6 SASI_Hs02_00513347 predicted 75
7 SASI_Hs02_00513348 predicted 53
8 SASI_Hs02_00513349 predicted 62
9 SASI_Hs02_00513350 predicted 111
10 SASI_Hs02_00513351 predicted 64
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513352 predicted 52
2 SASI_Hs02_00513353 predicted 123
3 SASI_Hs02_00513354 predicted 121
4 SASI_Hs02_00513355 predicted 88
5 SASI_Hs02_00513356 predicted 56
6 SASI_Hs02_00513357 predicted 72
7 SASI_Hs02_00513358 predicted 58
8 SASI_Hs02_00513359 predicted 65
9 SASI_Hs02_00513360 predicted 119
10 SASI_Hs02_00513361 predicted 59
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513362 predicted 52
2 SASI_Hs02_00513363 predicted 121
3 SASI_Hs02_00513364 predicted 123
4 SASI_Hs02_00513365 predicted 92
5 SASI_Hs02_00513366 predicted 47
6 SASI_Hs02_00513367 predicted 70
7 SASI_Hs02_00513368 predicted 56
8 SASI_Hs02_00513369 predicted 68
9 SASI_Hs02_00513370 predicted 117
10 SASI_Hs02_00513371 predicted 62
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014356
C6orf123 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 123
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-415s1c1
Sequence:CCGGGTGCCAGACACAGGTTTATTTCTCGAGAAATAAACCTGTGTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-417s1c1
Sequence:CCGGGCCAGACACAGGTTTATTTCACTCGAGTGAAATAAACCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-423s1c1
Sequence:CCGGCACAGGTTTATTTCAACACTGCTCGAGCAGTGTTGAAATAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-418s1c1
Sequence:CCGGCCAGACACAGGTTTATTTCAACTCGAGTTGAAATAAACCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-901s1c1
Sequence:CCGGGCAATGCTTTCATTCTGCTTTCTCGAGAAAGCAGAATGAAAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-419s1c1
Sequence:CCGGCAGACACAGGTTTATTTCAACCTCGAGGTTGAAATAAACCTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-362s1c1
Sequence:CCGGCTTCAGACTTCCCTTATGGAACTCGAGTTCCATAAGGGAAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-1580s1c1
Sequence:CCGGCCATGTTTCAGAGCATCTGATCTCGAGATCAGATGCTCTGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014356
C6orf123 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 123
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-415s1c1
Sequence:CCGGGTGCCAGACACAGGTTTATTTCTCGAGAAATAAACCTGTGTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-417s1c1
Sequence:CCGGGCCAGACACAGGTTTATTTCACTCGAGTGAAATAAACCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-423s1c1
Sequence:CCGGCACAGGTTTATTTCAACACTGCTCGAGCAGTGTTGAAATAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-418s1c1
Sequence:CCGGCCAGACACAGGTTTATTTCAACTCGAGTTGAAATAAACCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-901s1c1
Sequence:CCGGGCAATGCTTTCATTCTGCTTTCTCGAGAAAGCAGAATGAAAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-419s1c1
Sequence:CCGGCAGACACAGGTTTATTTCAACCTCGAGGTTGAAATAAACCTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-362s1c1
Sequence:CCGGCTTCAGACTTCCCTTATGGAACTCGAGTTCCATAAGGGAAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-1580s1c1
Sequence:CCGGCCATGTTTCAGAGCATCTGATCTCGAGATCAGATGCTCTGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014356
C6orf123 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 123
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-415s1c1
Sequence:CCGGGTGCCAGACACAGGTTTATTTCTCGAGAAATAAACCTGTGTCTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-417s1c1
Sequence:CCGGGCCAGACACAGGTTTATTTCACTCGAGTGAAATAAACCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-423s1c1
Sequence:CCGGCACAGGTTTATTTCAACACTGCTCGAGCAGTGTTGAAATAAACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-418s1c1
Sequence:CCGGCCAGACACAGGTTTATTTCAACTCGAGTTGAAATAAACCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-901s1c1
Sequence:CCGGGCAATGCTTTCATTCTGCTTTCTCGAGAAAGCAGAATGAAAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014356.2-419s1c1
Sequence:CCGGCAGACACAGGTTTATTTCAACCTCGAGGTTGAAATAAACCTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014356.2-362s1c1
Sequence:CCGGCTTCAGACTTCCCTTATGGAACTCGAGTTCCATAAGGGAAGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014356.2-1580s1c1
Sequence:CCGGCCATGTTTCAGAGCATCTGATCTCGAGATCAGATGCTCTGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks