EMAIL THIS PAGE TO A FRIEND

C6orf136

chromosome 6 open reading frame 136

Species: Human C6orf136(221545)
UniProtKB ID: Q5SQH8, A9R9P9, F8VX15, Q5SU01, Q6ZSB7, Q8TB84
Gene ID:
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109938 Rosetta Predictions human pricing
NM_145029 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324803 predicted 1120
2 SASI_Hs02_00324804 predicted 646
3 SASI_Hs02_00324805 predicted 939
4 SASI_Hs02_00324806 predicted 1056
5 SASI_Hs02_00324807 predicted 1052
6 SASI_Hs02_00324808 predicted 1218
7 SASI_Hs02_00324809 predicted 1017
8 SASI_Hs02_00324810 predicted 741
9 SASI_Hs02_00324811 predicted 947
10 SASI_Hs02_00324812 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102797 predicted 1269
2 SASI_Hs02_00364894 predicted 794
3 SASI_Hs01_00102801 predicted 1080
4 SASI_Hs02_00364895 predicted 1199
5 SASI_Hs02_00364896 predicted 1203
6 SASI_Hs02_00364897 predicted 1360
7 SASI_Hs01_00102803 predicted 1159
8 SASI_Hs01_00102804 predicted 886
9 SASI_Hs01_00102805 predicted 1090
10 SASI_Hs02_00364898 predicted 1076
11 SASI_Hs01_00102798 predicted 1101
12 SASI_Hs01_00102799 predicted 949
13 SASI_Hs01_00102800 predicted 912
14 SASI_Hs01_00102802 predicted 938
15 SASI_Hs01_00102806 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145029
VALIDATED
C6orf136 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 136
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1085s1c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1162s1c1
Sequence:CCGGGCCATCGTCTAGATAAACTGACTCGAGTCAGTTTATCTAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-845s1c1
Sequence:CCGGCGACTACAGTCTGTATTCCTTCTCGAGAAGGAATACAGACTGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-1260s1c1
Sequence:CCGGGAACCTGACTTAAACCTGTGTCTCGAGACACAGGTTTAAGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-855s1c1
Sequence:CCGGCTGTATTCCTTGGATGTGGAACTCGAGTTCCACATCCAAGGAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-890s21c1
Sequence:CCGGTCAATGAGATCCTCAACATACCTCGAGGTATGTTGAGGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1132s21c1
Sequence:GTACCGGTACTCCACTTTCTACCTGAATCTCGAGATTCAGGTAGAAAGTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145029.2-1434s21c1
Sequence:CCGGTGTAAAGCTGCTGTGTAATTTCTCGAGAAATTACACAGCAGCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1167s21c1
Sequence:CCGGTTGTCGCCATCGTCTAGATAACTCGAGTTATCTAGACGATGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1095s21c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145029
VALIDATED
C6orf136 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 136
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1085s1c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1162s1c1
Sequence:CCGGGCCATCGTCTAGATAAACTGACTCGAGTCAGTTTATCTAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-845s1c1
Sequence:CCGGCGACTACAGTCTGTATTCCTTCTCGAGAAGGAATACAGACTGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-1260s1c1
Sequence:CCGGGAACCTGACTTAAACCTGTGTCTCGAGACACAGGTTTAAGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-855s1c1
Sequence:CCGGCTGTATTCCTTGGATGTGGAACTCGAGTTCCACATCCAAGGAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-890s21c1
Sequence:CCGGTCAATGAGATCCTCAACATACCTCGAGGTATGTTGAGGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1132s21c1
Sequence:GTACCGGTACTCCACTTTCTACCTGAATCTCGAGATTCAGGTAGAAAGTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145029.2-1434s21c1
Sequence:CCGGTGTAAAGCTGCTGTGTAATTTCTCGAGAAATTACACAGCAGCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1167s21c1
Sequence:CCGGTTGTCGCCATCGTCTAGATAACTCGAGTTATCTAGACGATGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1095s21c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145029
VALIDATED
C6orf136 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 136
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1085s1c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-1162s1c1
Sequence:CCGGGCCATCGTCTAGATAAACTGACTCGAGTCAGTTTATCTAGACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-845s1c1
Sequence:CCGGCGACTACAGTCTGTATTCCTTCTCGAGAAGGAATACAGACTGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145029.1-1260s1c1
Sequence:CCGGGAACCTGACTTAAACCTGTGTCTCGAGACACAGGTTTAAGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_145029.1-855s1c1
Sequence:CCGGCTGTATTCCTTGGATGTGGAACTCGAGTTCCACATCCAAGGAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-890s21c1
Sequence:CCGGTCAATGAGATCCTCAACATACCTCGAGGTATGTTGAGGATCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1132s21c1
Sequence:GTACCGGTACTCCACTTTCTACCTGAATCTCGAGATTCAGGTAGAAAGTGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145029.2-1434s21c1
Sequence:CCGGTGTAAAGCTGCTGTGTAATTTCTCGAGAAATTACACAGCAGCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1167s21c1
Sequence:CCGGTTGTCGCCATCGTCTAGATAACTCGAGTTATCTAGACGATGGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145029.2-1095s21c1
Sequence:CCGGGCGTGACAAAGACGAGCATTACTCGAGTAATGCTCGTCTTTGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks