EMAIL THIS PAGE TO A FRIEND

C6orf141

chromosome 6 open reading frame 141

76 Gene Product Result for
Species: Human C6orf141(135398)
UniProtKB ID: Q5SZD1, A8K1H4, Q8N400, Q96NQ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036199 Anti-C6orf141 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153344 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153344 Rosetta Predictions human pricing
XR_040195 Rosetta Predictions human pricing
XR_040196 Rosetta Predictions human pricing
XR_040197 Rosetta Predictions human pricing
XR_040198 Rosetta Predictions human pricing
XR_040199 Rosetta Predictions human pricing
XR_040200 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149227 predicted 847
2 SASI_Hs01_00149228 predicted 819
3 SASI_Hs01_00149229 predicted 612
4 SASI_Hs01_00149230 predicted 607
5 SASI_Hs01_00149231 predicted 500
6 SASI_Hs01_00149232 predicted 506
7 SASI_Hs01_00149233 predicted 538
8 SASI_Hs01_00149234 predicted 832
9 SASI_Hs01_00149235 predicted 377
10 SASI_Hs01_00149236 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516759 predicted 466
2 SASI_Hs02_00516760 predicted 1086
3 SASI_Hs02_00516761 predicted 271
4 SASI_Hs02_00516762 predicted 580
5 SASI_Hs02_00516763 predicted 988
6 SASI_Hs02_00516764 predicted 981
7 SASI_Hs02_00516765 predicted 470
8 SASI_Hs02_00516766 predicted 1017
9 SASI_Hs02_00516767 predicted 1009
10 SASI_Hs02_00516768 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516769 predicted 1329
2 SASI_Hs02_00516770 predicted 465
3 SASI_Hs02_00516771 predicted 1367
4 SASI_Hs02_00516772 predicted 272
5 SASI_Hs02_00516773 predicted 1471
6 SASI_Hs02_00516774 predicted 1086
7 SASI_Hs02_00516775 predicted 578
8 SASI_Hs02_00516776 predicted 1013
9 SASI_Hs02_00516777 predicted 1497
10 SASI_Hs02_00516778 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516779 predicted 467
2 SASI_Hs02_00516780 predicted 1085
3 SASI_Hs02_00516781 predicted 272
4 SASI_Hs02_00516782 predicted 578
5 SASI_Hs02_00516783 predicted 986
6 SASI_Hs02_00516784 predicted 979
7 SASI_Hs02_00516785 predicted 470
8 SASI_Hs02_00516786 predicted 1010
9 SASI_Hs02_00516787 predicted 1014
10 SASI_Hs02_00516788 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516789 predicted 1331
2 SASI_Hs02_00516790 predicted 471
3 SASI_Hs02_00516791 predicted 1369
4 SASI_Hs02_00516792 predicted 270
5 SASI_Hs02_00516793 predicted 1464
6 SASI_Hs02_00516794 predicted 1085
7 SASI_Hs02_00516795 predicted 582
8 SASI_Hs02_00516796 predicted 1009
9 SASI_Hs02_00516797 predicted 1495
10 SASI_Hs02_00516798 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516799 predicted 1326
2 SASI_Hs02_00516800 predicted 468
3 SASI_Hs02_00516801 predicted 1365
4 SASI_Hs02_00516802 predicted 265
5 SASI_Hs02_00516803 predicted 1467
6 SASI_Hs02_00516804 predicted 1080
7 SASI_Hs02_00516805 predicted 577
8 SASI_Hs02_00516806 predicted 1014
9 SASI_Hs02_00516807 predicted 1498
10 SASI_Hs02_00516808 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516809 predicted 468
2 SASI_Hs02_00516810 predicted 1081
3 SASI_Hs02_00516811 predicted 274
4 SASI_Hs02_00516812 predicted 584
5 SASI_Hs02_00516813 predicted 984
6 SASI_Hs02_00516814 predicted 979
7 SASI_Hs02_00516815 predicted 464
8 SASI_Hs02_00516816 predicted 1018
9 SASI_Hs02_00516817 predicted 1012
10 SASI_Hs02_00516818 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145652
C6orf141 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 141
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-869s21c1
Sequence:CCGGTTGTGCGGGTGGAGGATTATCCTCGAGGATAATCCTCCACCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-776s21c1
Sequence:CCGGCCAACTACCCTTCTGTCTTTCCTCGAGGAAAGACAGAAGGGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-808s21c1
Sequence:CCGGCGAATTTCTGGCAGGCGTGTACTCGAGTACACGCCTGCCAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-1109s21c1
Sequence:CCGGTCGAGGAAATTAAACTCTAATCTCGAGATTAGAGTTTAATTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145652.1-1197s21c1
Sequence:CCGGGAGCTCCAACCTGCAATTAACCTCGAGGTTAATTGCAGGTTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145652
C6orf141 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 141
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-869s21c1
Sequence:CCGGTTGTGCGGGTGGAGGATTATCCTCGAGGATAATCCTCCACCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-776s21c1
Sequence:CCGGCCAACTACCCTTCTGTCTTTCCTCGAGGAAAGACAGAAGGGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-808s21c1
Sequence:CCGGCGAATTTCTGGCAGGCGTGTACTCGAGTACACGCCTGCCAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-1109s21c1
Sequence:CCGGTCGAGGAAATTAAACTCTAATCTCGAGATTAGAGTTTAATTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145652.1-1197s21c1
Sequence:CCGGGAGCTCCAACCTGCAATTAACCTCGAGGTTAATTGCAGGTTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145652
C6orf141 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 141
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-869s21c1
Sequence:CCGGTTGTGCGGGTGGAGGATTATCCTCGAGGATAATCCTCCACCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-776s21c1
Sequence:CCGGCCAACTACCCTTCTGTCTTTCCTCGAGGAAAGACAGAAGGGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-808s21c1
Sequence:CCGGCGAATTTCTGGCAGGCGTGTACTCGAGTACACGCCTGCCAGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145652.1-1109s21c1
Sequence:CCGGTCGAGGAAATTAAACTCTAATCTCGAGATTAGAGTTTAATTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145652.1-1197s21c1
Sequence:CCGGGAGCTCCAACCTGCAATTAACCTCGAGGTTAATTGCAGGTTGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153344
C6orf141 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 141
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-500s1c1
Sequence:CCGGCCCAACTACCCTTCTGTCTTTCTCGAGAAAGACAGAAGGGTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-379s1c1
Sequence:CCGGGAAAGTGCTCTTTCTCCTGCACTCGAGTGCAGGAGAAAGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-608s1c1
Sequence:CCGGGATTATCAGGTAACACAAGAACTCGAGTTCTTGTGTTACCTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153344
C6orf141 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 141
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-500s1c1
Sequence:CCGGCCCAACTACCCTTCTGTCTTTCTCGAGAAAGACAGAAGGGTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-379s1c1
Sequence:CCGGGAAAGTGCTCTTTCTCCTGCACTCGAGTGCAGGAGAAAGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-608s1c1
Sequence:CCGGGATTATCAGGTAACACAAGAACTCGAGTTCTTGTGTTACCTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153344
C6orf141 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 141
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-500s1c1
Sequence:CCGGCCCAACTACCCTTCTGTCTTTCTCGAGAAAGACAGAAGGGTAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-379s1c1
Sequence:CCGGGAAAGTGCTCTTTCTCCTGCACTCGAGTGCAGGAGAAAGAGCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153344.1-608s1c1
Sequence:CCGGGATTATCAGGTAACACAAGAACTCGAGTTCTTGTGTTACCTGATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks