EMAIL THIS PAGE TO A FRIEND

C6orf15

chromosome 6 open reading frame 15

26 Gene Product Result for
Synonyms: STG
Species: Human C6orf15(29113)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014070 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231311 MISSION® esiRNA esiRNA targeting human C6orf15 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014070 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214439 predicted 393
2 SASI_Hs01_00214440 predicted 630
3 SASI_Hs01_00214441 predicted 333
4 SASI_Hs01_00214442 predicted 850
5 SASI_Hs01_00214444 predicted 866
6 SASI_Hs01_00214445 predicted 861
7 SASI_Hs01_00214446 predicted 587
8 SASI_Hs02_00345102 predicted 211
9 SASI_Hs01_00214447 predicted 398
10 SASI_Hs02_00345103 predicted 388
11 SASI_Hs01_00214438 predicted 484
12 SASI_Hs01_00214443 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014070
C6orf15 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-983s1c1
Sequence:CCGGCGATAGAGGGAAACCCAACATCTCGAGATGTTGGGTTTCCCTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-165s1c1
Sequence:CCGGCTCTAACTCTGAACATCCGCACTCGAGTGCGGATGTTCAGAGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-859s1c1
Sequence:CCGGCATCTATACCCAGGTATCAATCTCGAGATTGATACCTGGGTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-984s1c1
Sequence:CCGGGATAGAGGGAAACCCAACATTCTCGAGAATGTTGGGTTTCCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-867s1c1
Sequence:CCGGCCCAGGTATCAATAACCCATTCTCGAGAATGGGTTATTGATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-992s1c1
Sequence:CCGGGAAACCCAACATTGGGAGTTACTCGAGTAACTCCCAATGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-200s1c1
Sequence:CCGGCTAGGTCTAATGACTTGGCAACTCGAGTTGCCAAGTCATTAGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-393s1c1
Sequence:CCGGGCCTGAAGAACTCTCTTACCTCTCGAGAGGTAAGAGAGTTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-390s1c1
Sequence:CCGGGCTGCCTGAAGAACTCTCTTACTCGAGTAAGAGAGTTCTTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-400s1c1
Sequence:CCGGGAACTCTCTTACCTCTCCAGTCTCGAGACTGGAGAGGTAAGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-199s1c1
Sequence:CCGGCCTAGGTCTAATGACTTGGCACTCGAGTGCCAAGTCATTAGACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014070
C6orf15 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-983s1c1
Sequence:CCGGCGATAGAGGGAAACCCAACATCTCGAGATGTTGGGTTTCCCTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-165s1c1
Sequence:CCGGCTCTAACTCTGAACATCCGCACTCGAGTGCGGATGTTCAGAGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-859s1c1
Sequence:CCGGCATCTATACCCAGGTATCAATCTCGAGATTGATACCTGGGTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-984s1c1
Sequence:CCGGGATAGAGGGAAACCCAACATTCTCGAGAATGTTGGGTTTCCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-867s1c1
Sequence:CCGGCCCAGGTATCAATAACCCATTCTCGAGAATGGGTTATTGATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-992s1c1
Sequence:CCGGGAAACCCAACATTGGGAGTTACTCGAGTAACTCCCAATGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-200s1c1
Sequence:CCGGCTAGGTCTAATGACTTGGCAACTCGAGTTGCCAAGTCATTAGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-393s1c1
Sequence:CCGGGCCTGAAGAACTCTCTTACCTCTCGAGAGGTAAGAGAGTTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-390s1c1
Sequence:CCGGGCTGCCTGAAGAACTCTCTTACTCGAGTAAGAGAGTTCTTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-400s1c1
Sequence:CCGGGAACTCTCTTACCTCTCCAGTCTCGAGACTGGAGAGGTAAGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-199s1c1
Sequence:CCGGCCTAGGTCTAATGACTTGGCACTCGAGTGCCAAGTCATTAGACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014070
C6orf15 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166777    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-983s1c1
Sequence:CCGGCGATAGAGGGAAACCCAACATCTCGAGATGTTGGGTTTCCCTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-165s1c1
Sequence:CCGGCTCTAACTCTGAACATCCGCACTCGAGTGCGGATGTTCAGAGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-859s1c1
Sequence:CCGGCATCTATACCCAGGTATCAATCTCGAGATTGATACCTGGGTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-984s1c1
Sequence:CCGGGATAGAGGGAAACCCAACATTCTCGAGAATGTTGGGTTTCCCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-867s1c1
Sequence:CCGGCCCAGGTATCAATAACCCATTCTCGAGAATGGGTTATTGATACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163704    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014070.1-992s1c1
Sequence:CCGGGAAACCCAACATTGGGAGTTACTCGAGTAACTCCCAATGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-200s1c1
Sequence:CCGGCTAGGTCTAATGACTTGGCAACTCGAGTTGCCAAGTCATTAGACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-393s1c1
Sequence:CCGGGCCTGAAGAACTCTCTTACCTCTCGAGAGGTAAGAGAGTTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-390s1c1
Sequence:CCGGGCTGCCTGAAGAACTCTCTTACTCGAGTAAGAGAGTTCTTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-400s1c1
Sequence:CCGGGAACTCTCTTACCTCTCCAGTCTCGAGACTGGAGAGGTAAGAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014070.1-199s1c1
Sequence:CCGGCCTAGGTCTAATGACTTGGCACTCGAGTGCCAAGTCATTAGACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks