EMAIL THIS PAGE TO A FRIEND

C6orf163

chromosome 6 open reading frame 163

49 Gene Product Result for
UniProtKB ID: Q5TEZ5
Gene ID:
chicken(421826) chromosome 3 open reading frame, human C6orf163
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010868 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141851 MISSION® esiRNA esiRNA human C6orf163 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010868 Rosetta Predictions human pricing
XM_001720089 Rosetta Predictions human pricing
XM_001720635 Rosetta Predictions human pricing
XM_001725542 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240546 predicted 1514
2 SASI_Hs01_00240547 predicted 1493
3 SASI_Hs01_00240548 predicted 1641
4 SASI_Hs01_00240549 predicted 1532
5 SASI_Hs01_00240550 predicted 1494
6 SASI_Hs01_00240551 predicted 1695
7 SASI_Hs01_00240552 predicted 1621
8 SASI_Hs01_00240553 predicted 1787
9 SASI_Hs01_00240554 predicted 1610
10 SASI_Hs01_00240555 predicted 1627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434468 predicted 1500
2 SASI_Hs02_00434469 predicted 1631
3 SASI_Hs02_00434470 predicted 1530
4 SASI_Hs02_00434471 predicted 1692
5 SASI_Hs02_00434472 predicted 1608
6 SASI_Hs02_00434473 predicted 1787
7 SASI_Hs02_00434474 predicted 1606
8 SASI_Hs02_00434475 predicted 1627
9 SASI_Hs02_00434476 predicted 1496
10 SASI_Hs02_00434477 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00437876 predicted 1505
2 SASI_Hs02_00437877 predicted 1637
3 SASI_Hs02_00437878 predicted 1529
4 SASI_Hs02_00437879 predicted 1688
5 SASI_Hs02_00437880 predicted 1611
6 SASI_Hs02_00437881 predicted 1782
7 SASI_Hs02_00437882 predicted 1606
8 SASI_Hs02_00437883 predicted 1622
9 SASI_Hs02_00437884 predicted 1495
10 SASI_Hs02_00437885 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00468427 predicted 1502
2 SASI_Hs02_00468428 predicted 1633
3 SASI_Hs02_00468429 predicted 1528
4 SASI_Hs02_00468430 predicted 1694
5 SASI_Hs02_00468431 predicted 1615
6 SASI_Hs02_00468432 predicted 1784
7 SASI_Hs02_00468433 predicted 1606
8 SASI_Hs02_00468434 predicted 1623
9 SASI_Hs02_00468435 predicted 1494
10 SASI_Hs02_00468436 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010868
C6orf163 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 163
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1748s1c1
Sequence:CCGGGTACAGGAAGTGCTTCAAGAACTCGAGTTCTTGAAGCACTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1742s1c1
Sequence:CCGGGAAGAGGTACAGGAAGTGCTTCTCGAGAAGCACTTCCTGTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1488s1c1
Sequence:CCGGGCATGGTCCACAGAATCCAAACTCGAGTTTGGATTCTGTGGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1904s1c1
Sequence:CCGGGAAACCAGGATGGCATTTCAACTCGAGTTGAAATGCCATCCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1880s1c1
Sequence:CCGGGATTTCCTAGAGGAGGAATTACTCGAGTAATTCCTCCTCTAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1495s1c1
Sequence:CCGGCCACAGAATCCAAAGGATTATCTCGAGATAATCCTTTGGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1619s1c1
Sequence:CCGGGAGGAAATTGTGAATACTGGTCTCGAGACCAGTATTCACAATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-476s21c1
Sequence:CCGGGAAGTATGGGCTCAGGCTAATCTCGAGATTAGCCTGAGCCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-447s21c1
Sequence:CCGGTCAGAGAACACATTGCGAAAGCTCGAGCTTTCGCAATGTGTTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-344s21c1
Sequence:CCGGCATGAATACAAGCCACTTAAGCTCGAGCTTAAGTGGCTTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010868
C6orf163 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 163
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1748s1c1
Sequence:CCGGGTACAGGAAGTGCTTCAAGAACTCGAGTTCTTGAAGCACTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1742s1c1
Sequence:CCGGGAAGAGGTACAGGAAGTGCTTCTCGAGAAGCACTTCCTGTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1488s1c1
Sequence:CCGGGCATGGTCCACAGAATCCAAACTCGAGTTTGGATTCTGTGGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1904s1c1
Sequence:CCGGGAAACCAGGATGGCATTTCAACTCGAGTTGAAATGCCATCCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1880s1c1
Sequence:CCGGGATTTCCTAGAGGAGGAATTACTCGAGTAATTCCTCCTCTAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1495s1c1
Sequence:CCGGCCACAGAATCCAAAGGATTATCTCGAGATAATCCTTTGGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1619s1c1
Sequence:CCGGGAGGAAATTGTGAATACTGGTCTCGAGACCAGTATTCACAATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-476s21c1
Sequence:CCGGGAAGTATGGGCTCAGGCTAATCTCGAGATTAGCCTGAGCCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-447s21c1
Sequence:CCGGTCAGAGAACACATTGCGAAAGCTCGAGCTTTCGCAATGTGTTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-344s21c1
Sequence:CCGGCATGAATACAAGCCACTTAAGCTCGAGCTTAAGTGGCTTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010868
C6orf163 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 163
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1748s1c1
Sequence:CCGGGTACAGGAAGTGCTTCAAGAACTCGAGTTCTTGAAGCACTTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1742s1c1
Sequence:CCGGGAAGAGGTACAGGAAGTGCTTCTCGAGAAGCACTTCCTGTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010868.1-1488s1c1
Sequence:CCGGGCATGGTCCACAGAATCCAAACTCGAGTTTGGATTCTGTGGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1904s1c1
Sequence:CCGGGAAACCAGGATGGCATTTCAACTCGAGTTGAAATGCCATCCTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1880s1c1
Sequence:CCGGGATTTCCTAGAGGAGGAATTACTCGAGTAATTCCTCCTCTAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1495s1c1
Sequence:CCGGCCACAGAATCCAAAGGATTATCTCGAGATAATCCTTTGGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010868.1-1619s1c1
Sequence:CCGGGAGGAAATTGTGAATACTGGTCTCGAGACCAGTATTCACAATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-476s21c1
Sequence:CCGGGAAGTATGGGCTCAGGCTAATCTCGAGATTAGCCTGAGCCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-447s21c1
Sequence:CCGGTCAGAGAACACATTGCGAAAGCTCGAGCTTTCGCAATGTGTTCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010868.2-344s21c1
Sequence:CCGGCATGAATACAAGCCACTTAAGCTCGAGCTTAAGTGGCTTGTATTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks