EMAIL THIS PAGE TO A FRIEND

C6orf165

chromosome 6 open reading frame 165

32 Gene Product Result for
Synonyms: dJ382I10.1
UniProtKB ID: Q8IYR0, A8K969, E1P507, Q8N9U4
Gene ID:
chicken(421824) chromosome 3 open reading frame, human C6orf165
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178823 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225951 MISSION® esiRNA esiRNA targeting human C6orf165 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031743 Rosetta Predictions human pricing
NM_178823 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082778 predicted 483
2 SASI_Hs02_00307805 predicted 1079
3 SASI_Hs01_00082780 predicted 638
4 SASI_Hs01_00082781 predicted 1190
5 SASI_Hs01_00082782 predicted 1245
6 SASI_Hs01_00082783 predicted 763
7 SASI_Hs01_00082784 predicted 656
8 SASI_Hs01_00082785 predicted 286
9 SASI_Hs01_00082786 predicted 1030
10 SASI_Hs01_00082787 predicted 275
11 SASI_Hs01_00082779 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127598 predicted 467
2 SASI_Hs02_00369868 predicted 1069
3 SASI_Hs01_00127600 predicted 632
4 SASI_Hs01_00127601 predicted 1185
5 SASI_Hs01_00127602 predicted 1228
6 SASI_Hs01_00127603 predicted 752
7 SASI_Hs01_00127604 predicted 639
8 SASI_Hs01_00127605 predicted 275
9 SASI_Hs01_00127606 predicted 1025
10 SASI_Hs01_00127607 predicted 256
11 SASI_Hs01_00127599 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178823
C6orf165 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 165
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-389s1c1
Sequence:CCGGCGGGTCCTAGAGTCTAGATTACTCGAGTAATCTAGACTCTAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178823.2-2404s1c1
Sequence:CCGGGTCTCAAACTTGTGGCTTCAACTCGAGTTGAAGCCACAAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-751s1c1
Sequence:CCGGGCAGCATATTGATTACCAGCTCTCGAGAGCTGGTAATCAATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-475s1c1
Sequence:CCGGCCGGAAGATTATCAGCTATGTCTCGAGACATAGCTGATAATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178823.2-2036s1c1
Sequence:CCGGCCACTTATTGTGTGTCAGTAACTCGAGTTACTGACACACAATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-752s1c1
Sequence:CCGGCAGCATATTGATTACCAGCTTCTCGAGAAGCTGGTAATCAATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-1026s1c1
Sequence:CCGGCAACATCACAAGTCTTTCCTACTCGAGTAGGAAAGACTTGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-890s1c1
Sequence:CCGGCGACAATATGAGGTCTTCCTTCTCGAGAAGGAAGACCTCATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178823
C6orf165 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 165
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-389s1c1
Sequence:CCGGCGGGTCCTAGAGTCTAGATTACTCGAGTAATCTAGACTCTAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178823.2-2404s1c1
Sequence:CCGGGTCTCAAACTTGTGGCTTCAACTCGAGTTGAAGCCACAAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-751s1c1
Sequence:CCGGGCAGCATATTGATTACCAGCTCTCGAGAGCTGGTAATCAATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-475s1c1
Sequence:CCGGCCGGAAGATTATCAGCTATGTCTCGAGACATAGCTGATAATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178823.2-2036s1c1
Sequence:CCGGCCACTTATTGTGTGTCAGTAACTCGAGTTACTGACACACAATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-752s1c1
Sequence:CCGGCAGCATATTGATTACCAGCTTCTCGAGAAGCTGGTAATCAATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-1026s1c1
Sequence:CCGGCAACATCACAAGTCTTTCCTACTCGAGTAGGAAAGACTTGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-890s1c1
Sequence:CCGGCGACAATATGAGGTCTTCCTTCTCGAGAAGGAAGACCTCATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178823
C6orf165 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 165
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-389s1c1
Sequence:CCGGCGGGTCCTAGAGTCTAGATTACTCGAGTAATCTAGACTCTAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178823.2-2404s1c1
Sequence:CCGGGTCTCAAACTTGTGGCTTCAACTCGAGTTGAAGCCACAAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-751s1c1
Sequence:CCGGGCAGCATATTGATTACCAGCTCTCGAGAGCTGGTAATCAATATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-475s1c1
Sequence:CCGGCCGGAAGATTATCAGCTATGTCTCGAGACATAGCTGATAATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178823.2-2036s1c1
Sequence:CCGGCCACTTATTGTGTGTCAGTAACTCGAGTTACTGACACACAATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-752s1c1
Sequence:CCGGCAGCATATTGATTACCAGCTTCTCGAGAAGCTGGTAATCAATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178823.2-1026s1c1
Sequence:CCGGCAACATCACAAGTCTTTCCTACTCGAGTAGGAAAGACTTGTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178823.2-890s1c1
Sequence:CCGGCGACAATATGAGGTCTTCCTTCTCGAGAAGGAAGACCTCATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks