EMAIL THIS PAGE TO A FRIEND

C6orf195

chromosome 6 open reading frame 195

20 Gene Product Result for
Synonyms: RP11-145H9.2 bA145H9.2
Species: Human C6orf195(154386)
UniProtKB ID: Q96MT4, Q3SY08, Q3SY09, Q3SY10, Q5TAW4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197178 predicted 1634
2 SASI_Hs01_00197179 predicted 1266
3 SASI_Hs01_00197180 predicted 1501
4 SASI_Hs01_00197181 predicted 1797
5 SASI_Hs02_00366365 predicted 1319
6 SASI_Hs01_00197182 predicted 1421
7 SASI_Hs02_00366366 predicted 1535
8 SASI_Hs01_00197183 predicted 1125
9 SASI_Hs01_00197184 predicted 1638
10 SASI_Hs02_00366367 predicted 1600
11 SASI_Hs01_00197185 predicted 1254
12 SASI_Hs01_00197186 predicted 596
13 SASI_Hs01_00197187 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152554
C6orf195 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 195
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-603s1c1
Sequence:CCGGGAAAGGGCATTTGATGGCATGCTCGAGCATGCCATCAAATGCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-808s1c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1269s21c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1309s21c1
Sequence:CCGGCCATCTGAGAAGCCCAGAAACCTCGAGGTTTCTGGGCTTCTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152554.2-1839s21c1
Sequence:CCGGTTGCATGATCTGAGCTAATTTCTCGAGAAATTAGCTCAGATCATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1333s21c1
Sequence:CCGGCTTCCGTCAGAGGGAGATTAGCTCGAGCTAATCTCCCTCTGACGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1126s21c1
Sequence:CCGGGCTACAGCATGCCTCAGATTGCTCGAGCAATCTGAGGCATGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152554
C6orf195 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 195
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-603s1c1
Sequence:CCGGGAAAGGGCATTTGATGGCATGCTCGAGCATGCCATCAAATGCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-808s1c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1269s21c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1309s21c1
Sequence:CCGGCCATCTGAGAAGCCCAGAAACCTCGAGGTTTCTGGGCTTCTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152554.2-1839s21c1
Sequence:CCGGTTGCATGATCTGAGCTAATTTCTCGAGAAATTAGCTCAGATCATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1333s21c1
Sequence:CCGGCTTCCGTCAGAGGGAGATTAGCTCGAGCTAATCTCCCTCTGACGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1126s21c1
Sequence:CCGGGCTACAGCATGCCTCAGATTGCTCGAGCAATCTGAGGCATGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152554
C6orf195 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 195
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-603s1c1
Sequence:CCGGGAAAGGGCATTTGATGGCATGCTCGAGCATGCCATCAAATGCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152554.1-808s1c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1269s21c1
Sequence:CCGGCCACACCCTTCAAGATCAACACTCGAGTGTTGATCTTGAAGGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1309s21c1
Sequence:CCGGCCATCTGAGAAGCCCAGAAACCTCGAGGTTTCTGGGCTTCTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152554.2-1839s21c1
Sequence:CCGGTTGCATGATCTGAGCTAATTTCTCGAGAAATTAGCTCAGATCATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1333s21c1
Sequence:CCGGCTTCCGTCAGAGGGAGATTAGCTCGAGCTAATCTCCCTCTGACGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152554.2-1126s21c1
Sequence:CCGGGCTACAGCATGCCTCAGATTGCTCGAGCAATCTGAGGCATGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)