EMAIL THIS PAGE TO A FRIEND

C6orf1

chromosome 6 open reading frame 1

105 Gene Product Result for
Synonyms: LBH
Species: Human C6orf1(221491)
UniProtKB ID: Q86T20, A8K299
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008703 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083921 MISSION® esiRNA esiRNA human C6orf1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008703 Rosetta Predictions human pricing
NM_001008704 Rosetta Predictions human pricing
NM_178508 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201667 predicted 620
2 SASI_Hs01_00201668 predicted 711
3 SASI_Hs02_00305534 predicted 660
4 SASI_Hs01_00201670 predicted 699
5 SASI_Hs01_00201671 predicted 665
6 SASI_Hs01_00201672 predicted 716
7 SASI_Hs01_00201673 predicted 627
8 SASI_Hs01_00201674 predicted 665
9 SASI_Hs01_00201675 predicted 393
10 SASI_Hs01_00201676 predicted 893
11 SASI_Hs01_00201669 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208604 predicted 565
2 SASI_Hs01_00208605 predicted 655
3 SASI_Hs02_00305535 predicted 597
4 SASI_Hs01_00208607 predicted 643
5 SASI_Hs01_00208608 predicted 600
6 SASI_Hs01_00208609 predicted 651
7 SASI_Hs01_00208610 predicted 566
8 SASI_Hs01_00208611 predicted 602
9 SASI_Hs01_00208612 predicted 338
10 SASI_Hs01_00208613 predicted 832
11 SASI_Hs01_00208606 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018084 predicted 874
2 SASI_Hs01_00018085 predicted 968
3 SASI_Hs02_00369750 predicted 915
4 SASI_Hs01_00018087 predicted 950
5 SASI_Hs01_00018088 predicted 918
6 SASI_Hs01_00018089 predicted 969
7 SASI_Hs01_00018090 predicted 873
8 SASI_Hs01_00018091 predicted 920
9 SASI_Hs01_00018092 predicted 648
10 SASI_Hs01_00018093 predicted 1144
11 SASI_Hs01_00018086 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008703
VALIDATED
C6orf1 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-625s21c1
Sequence:CCGGCTGGGTGCTGGGTCTCCATTTCTCGAGAAATGGAGACCCAGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-399s21c1
Sequence:CCGGCTATGACCCAGCTGAGGAACTCTCGAGAGTTCCTCAGCTGGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008703.1-720s21c1
Sequence:CCGGCCTTTGTGGGTGTTGAGCTCACTCGAGTGAGCTCAACACCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-504s21c1
Sequence:CCGGGATGCCACTGCTGGATGTCAACTCGAGTTGACATCCAGCAGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-757s21c1
Sequence:CCGGACTCATGGGAAGAGGCTTTCCCTCGAGGGAAAGCCTCTTCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008703
VALIDATED
C6orf1 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-625s21c1
Sequence:CCGGCTGGGTGCTGGGTCTCCATTTCTCGAGAAATGGAGACCCAGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-399s21c1
Sequence:CCGGCTATGACCCAGCTGAGGAACTCTCGAGAGTTCCTCAGCTGGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008703.1-720s21c1
Sequence:CCGGCCTTTGTGGGTGTTGAGCTCACTCGAGTGAGCTCAACACCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-504s21c1
Sequence:CCGGGATGCCACTGCTGGATGTCAACTCGAGTTGACATCCAGCAGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-757s21c1
Sequence:CCGGACTCATGGGAAGAGGCTTTCCCTCGAGGGAAAGCCTCTTCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008703
VALIDATED
C6orf1 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-625s21c1
Sequence:CCGGCTGGGTGCTGGGTCTCCATTTCTCGAGAAATGGAGACCCAGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-399s21c1
Sequence:CCGGCTATGACCCAGCTGAGGAACTCTCGAGAGTTCCTCAGCTGGGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008703.1-720s21c1
Sequence:CCGGCCTTTGTGGGTGTTGAGCTCACTCGAGTGAGCTCAACACCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-504s21c1
Sequence:CCGGGATGCCACTGCTGGATGTCAACTCGAGTTGACATCCAGCAGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008703.1-757s21c1
Sequence:CCGGACTCATGGGAAGAGGCTTTCCCTCGAGGGAAAGCCTCTTCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks