EMAIL THIS PAGE TO A FRIEND

C6orf201

chromosome 6 open reading frame 201

44 Gene Product Result for
Synonyms: dJ1013A10.5
Species: Human C6orf201(404220)
UniProtKB ID: Q7Z4U5, A6NLI6, Q6NXN5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206834 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114121 MISSION® esiRNA esiRNA human C6orf201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085401 Rosetta Predictions human pricing
NM_206834 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317615 predicted 815
2 SASI_Hs02_00317616 predicted 892
3 SASI_Hs02_00317617 predicted 968
4 SASI_Hs02_00317618 predicted 1021
5 SASI_Hs02_00317619 predicted 1266
6 SASI_Hs02_00317620 predicted 988
7 SASI_Hs02_00317621 predicted 1290
8 SASI_Hs02_00317622 predicted 826
9 SASI_Hs02_00317623 predicted 1315
10 SASI_Hs02_00317624 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086840 predicted 502
2 SASI_Hs01_00086841 predicted 786
3 SASI_Hs01_00086842 predicted 643
4 SASI_Hs01_00086843 predicted 768
5 SASI_Hs01_00086844 predicted 818
6 SASI_Hs01_00086845 predicted 1009
7 SASI_Hs01_00086846 predicted 929
8 SASI_Hs01_00086847 predicted 1029
9 SASI_Hs01_00086848 predicted 691
10 SASI_Hs01_00086849 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206834
C6orf201 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 201
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-583s1c1
Sequence:CCGGCAATGTAACTGACGGGTGGAACTCGAGTTCCACCCGTCAGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-595s1c1
Sequence:CCGGCGGGTGGAAGAAATGTCACTTCTCGAGAAGTGACATTTCTTCCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1141s1c1
Sequence:CCGGGCCCACAAATTCCCTACAGAACTCGAGTTCTGTAGGGAATTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-701s1c1
Sequence:CCGGCTAAGGAATACAAGCAGGAAACTCGAGTTTCCTGCTTGTATTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-598s1c1
Sequence:CCGGGTGGAAGAAATGTCACTTGTTCTCGAGAACAAGTGACATTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-2013s1c1
Sequence:CCGGGCACAAATCAAACAAGAGATACTCGAGTATCTCTTGTTTGATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1387s1c1
Sequence:CCGGCCCTGGTTTGAATCTTGTATTCTCGAGAATACAAGATTCAAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-693s1c1
Sequence:CCGGGACACAGCCTAAGGAATACAACTCGAGTTGTATTCCTTAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-722s1c1
Sequence:CCGGCTGAGAAACCTGCCAACAACACTCGAGTGTTGTTGGCAGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206834
C6orf201 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 201
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-583s1c1
Sequence:CCGGCAATGTAACTGACGGGTGGAACTCGAGTTCCACCCGTCAGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-595s1c1
Sequence:CCGGCGGGTGGAAGAAATGTCACTTCTCGAGAAGTGACATTTCTTCCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1141s1c1
Sequence:CCGGGCCCACAAATTCCCTACAGAACTCGAGTTCTGTAGGGAATTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-701s1c1
Sequence:CCGGCTAAGGAATACAAGCAGGAAACTCGAGTTTCCTGCTTGTATTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-598s1c1
Sequence:CCGGGTGGAAGAAATGTCACTTGTTCTCGAGAACAAGTGACATTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-2013s1c1
Sequence:CCGGGCACAAATCAAACAAGAGATACTCGAGTATCTCTTGTTTGATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1387s1c1
Sequence:CCGGCCCTGGTTTGAATCTTGTATTCTCGAGAATACAAGATTCAAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-693s1c1
Sequence:CCGGGACACAGCCTAAGGAATACAACTCGAGTTGTATTCCTTAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-722s1c1
Sequence:CCGGCTGAGAAACCTGCCAACAACACTCGAGTGTTGTTGGCAGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206834
C6orf201 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 201
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-583s1c1
Sequence:CCGGCAATGTAACTGACGGGTGGAACTCGAGTTCCACCCGTCAGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-595s1c1
Sequence:CCGGCGGGTGGAAGAAATGTCACTTCTCGAGAAGTGACATTTCTTCCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1141s1c1
Sequence:CCGGGCCCACAAATTCCCTACAGAACTCGAGTTCTGTAGGGAATTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-701s1c1
Sequence:CCGGCTAAGGAATACAAGCAGGAAACTCGAGTTTCCTGCTTGTATTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-598s1c1
Sequence:CCGGGTGGAAGAAATGTCACTTGTTCTCGAGAACAAGTGACATTTCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-2013s1c1
Sequence:CCGGGCACAAATCAAACAAGAGATACTCGAGTATCTCTTGTTTGATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160514    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206834.1-1387s1c1
Sequence:CCGGCCCTGGTTTGAATCTTGTATTCTCGAGAATACAAGATTCAAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-693s1c1
Sequence:CCGGGACACAGCCTAAGGAATACAACTCGAGTTGTATTCCTTAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206834.1-722s1c1
Sequence:CCGGCTGAGAAACCTGCCAACAACACTCGAGTGTTGTTGGCAGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks