EMAIL THIS PAGE TO A FRIEND

C6orf203

chromosome 6 open reading frame 203

20 Gene Product Result for
Synonyms: PRED31 RP11-59I9.1
Species: Human C6orf203(51250)
UniProtKB ID: Q9P0P8, B3KRG9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016487 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034311 MISSION® esiRNA esiRNA human C6orf203 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016487 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020761 predicted 425
2 SASI_Hs01_00020762 predicted 545
3 SASI_Hs01_00020763 predicted 253
4 SASI_Hs01_00020764 predicted 605
5 SASI_Hs01_00020765 predicted 488
6 SASI_Hs01_00020767 predicted 202
7 SASI_Hs01_00020768 predicted 396
8 SASI_Hs01_00020769 predicted 252
9 SASI_Hs01_00020770 predicted 652
10 SASI_Hs02_00349547 predicted 423
11 SASI_Hs01_00020766 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016487
VALIDATED
C6orf203 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 203
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016487.2-432s1c1
Sequence:CCGGCTTGAGGATGATCCTACTGTACTCGAGTACAGTAGGATCATCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-147s21c1
Sequence:CCGGCGAGGGACACCTTCATCATACCTCGAGGTATGATGAAGGTGTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-280s21c1
Sequence:CCGGTACTATCTCCAGAATGTATTTCTCGAGAAATACATTCTGGAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-637s21c1
Sequence:CCGGTTCTCATTGGAGAGGATAAAGCTCGAGCTTTATCCTCTCCAATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016487.2-612s21c1
Sequence:CCGGGTGAAAGTGGGAGATACATTGCTCGAGCAATGTATCTCCCACTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-212s21c1
Sequence:CCGGCAAGTTACGTGCACCAAATTACTCGAGTAATTTGGTGCACGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016487
VALIDATED
C6orf203 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 203
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016487.2-432s1c1
Sequence:CCGGCTTGAGGATGATCCTACTGTACTCGAGTACAGTAGGATCATCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-147s21c1
Sequence:CCGGCGAGGGACACCTTCATCATACCTCGAGGTATGATGAAGGTGTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-280s21c1
Sequence:CCGGTACTATCTCCAGAATGTATTTCTCGAGAAATACATTCTGGAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-637s21c1
Sequence:CCGGTTCTCATTGGAGAGGATAAAGCTCGAGCTTTATCCTCTCCAATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016487.2-612s21c1
Sequence:CCGGGTGAAAGTGGGAGATACATTGCTCGAGCAATGTATCTCCCACTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-212s21c1
Sequence:CCGGCAAGTTACGTGCACCAAATTACTCGAGTAATTTGGTGCACGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016487
VALIDATED
C6orf203 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 203
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016487.2-432s1c1
Sequence:CCGGCTTGAGGATGATCCTACTGTACTCGAGTACAGTAGGATCATCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-147s21c1
Sequence:CCGGCGAGGGACACCTTCATCATACCTCGAGGTATGATGAAGGTGTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-280s21c1
Sequence:CCGGTACTATCTCCAGAATGTATTTCTCGAGAAATACATTCTGGAGATAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-637s21c1
Sequence:CCGGTTCTCATTGGAGAGGATAAAGCTCGAGCTTTATCCTCTCCAATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016487.2-612s21c1
Sequence:CCGGGTGAAAGTGGGAGATACATTGCTCGAGCAATGTATCTCCCACTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016487.2-212s21c1
Sequence:CCGGCAAGTTACGTGCACCAAATTACTCGAGTAATTTGGTGCACGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks