EMAIL THIS PAGE TO A FRIEND

C6orf211

chromosome 6 open reading frame 211

32 Gene Product Result for
UniProtKB ID: Q9H993, Q96FC6, Q9UFY5
Gene ID:
chicken(421637) chromosome 3 open reading frame, human C6orf211
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024573 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023631 MISSION® esiRNA esiRNA human C6orf211 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024573 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077012 predicted 865
2 SASI_Hs01_00077013 predicted 987
3 SASI_Hs01_00077014 predicted 993
4 SASI_Hs01_00077015 predicted 1125
5 SASI_Hs01_00077016 predicted 520
6 SASI_Hs01_00077017 predicted 1674
7 SASI_Hs01_00077018 predicted 656
8 SASI_Hs01_00077019 predicted 1228
9 SASI_Hs01_00077020 predicted 741
10 SASI_Hs02_00356890 predicted 1444
11 SASI_Hs01_00077021 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024573
VALIDATED
C6orf211 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 211
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-647s21c1
Sequence:CCGGCAGAGTCCACCAATCGATTACCTCGAGGTAATCGATTGGTGGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-358s21c1
Sequence:CCGGTGATACATTGCATCGACATAACTCGAGTTATGTCGATGCAATGTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024573.1-1950s21c1
Sequence:CCGGTAGTACACTGCATGGTATTTACTCGAGTAAATACCATGCAGTGTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-1240s21c1
Sequence:CCGGATGGGTTTACCACAATCATATCTCGAGATATGATTGTGGTAAACCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-287s21c1
Sequence:CCGGGGACAGGACGTGGGATCATTTCTCGAGAAATGATCCCACGTCCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-999s1c1
Sequence:CCGGGAGTGTATATTGTTCTCGATACTCGAGTATCGAGAACAATATACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-2012s1c1
Sequence:CCGGGCACATGAAATAATAGCTCTACTCGAGTAGAGCTATTATTTCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-1322s1c1
Sequence:CCGGGAACTACAGAAGGCACATTTACTCGAGTAAATGTGCCTTCTGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-455s1c1
Sequence:CCGGCGGAATGAATTGCAAACAGATCTCGAGATCTGTTTGCAATTCATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1440s1c1
Sequence:CCGGCTGCACCACTCTGTACCATAACTCGAGTTATGGTACAGAGTGGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1409s1c1
Sequence:CCGGCCATTTCATCAGGCTCTGAATCTCGAGATTCAGAGCCTGATGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024573
VALIDATED
C6orf211 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 211
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-647s21c1
Sequence:CCGGCAGAGTCCACCAATCGATTACCTCGAGGTAATCGATTGGTGGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-358s21c1
Sequence:CCGGTGATACATTGCATCGACATAACTCGAGTTATGTCGATGCAATGTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024573.1-1950s21c1
Sequence:CCGGTAGTACACTGCATGGTATTTACTCGAGTAAATACCATGCAGTGTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-1240s21c1
Sequence:CCGGATGGGTTTACCACAATCATATCTCGAGATATGATTGTGGTAAACCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-287s21c1
Sequence:CCGGGGACAGGACGTGGGATCATTTCTCGAGAAATGATCCCACGTCCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-999s1c1
Sequence:CCGGGAGTGTATATTGTTCTCGATACTCGAGTATCGAGAACAATATACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-2012s1c1
Sequence:CCGGGCACATGAAATAATAGCTCTACTCGAGTAGAGCTATTATTTCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-1322s1c1
Sequence:CCGGGAACTACAGAAGGCACATTTACTCGAGTAAATGTGCCTTCTGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-455s1c1
Sequence:CCGGCGGAATGAATTGCAAACAGATCTCGAGATCTGTTTGCAATTCATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1440s1c1
Sequence:CCGGCTGCACCACTCTGTACCATAACTCGAGTTATGGTACAGAGTGGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1409s1c1
Sequence:CCGGCCATTTCATCAGGCTCTGAATCTCGAGATTCAGAGCCTGATGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024573
VALIDATED
C6orf211 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 211
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-647s21c1
Sequence:CCGGCAGAGTCCACCAATCGATTACCTCGAGGTAATCGATTGGTGGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-358s21c1
Sequence:CCGGTGATACATTGCATCGACATAACTCGAGTTATGTCGATGCAATGTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024573.1-1950s21c1
Sequence:CCGGTAGTACACTGCATGGTATTTACTCGAGTAAATACCATGCAGTGTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-1240s21c1
Sequence:CCGGATGGGTTTACCACAATCATATCTCGAGATATGATTGTGGTAAACCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024573.1-287s21c1
Sequence:CCGGGGACAGGACGTGGGATCATTTCTCGAGAAATGATCCCACGTCCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-999s1c1
Sequence:CCGGGAGTGTATATTGTTCTCGATACTCGAGTATCGAGAACAATATACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-2012s1c1
Sequence:CCGGGCACATGAAATAATAGCTCTACTCGAGTAGAGCTATTATTTCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-1322s1c1
Sequence:CCGGGAACTACAGAAGGCACATTTACTCGAGTAAATGTGCCTTCTGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024573.1-455s1c1
Sequence:CCGGCGGAATGAATTGCAAACAGATCTCGAGATCTGTTTGCAATTCATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1440s1c1
Sequence:CCGGCTGCACCACTCTGTACCATAACTCGAGTTATGGTACAGAGTGGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024573.1-1409s1c1
Sequence:CCGGCCATTTCATCAGGCTCTGAATCTCGAGATTCAGAGCCTGATGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)