EMAIL THIS PAGE TO A FRIEND

C6orf222

chromosome 6 open reading frame 222

63 Gene Product Result for
Species: Human C6orf222(389384)
UniProtKB ID: P0C671, B2RTY8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010903 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045321 MISSION® esiRNA esiRNA human C6orf222 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010903 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118836 predicted 1810
2 SASI_Hs01_00118838 predicted 1966
3 SASI_Hs02_00305878 predicted 873
4 SASI_Hs01_00118839 predicted 1943
5 SASI_Hs01_00118840 predicted 1010
6 SASI_Hs01_00118841 predicted 1980
7 SASI_Hs01_00118842 predicted 1972
8 SASI_Hs01_00118843 predicted 2092
9 SASI_Hs01_00118844 predicted 814
10 SASI_Hs02_00305879 predicted 1049
11 SASI_Hs01_00118837 predicted 617
12 SASI_Hs01_00118845 predicted 2048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010903
C6orf222 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 222
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1510s1c1
Sequence:CCGGCCATAAGAAACACACCTCCAACTCGAGTTGGAGGTGTGTTTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-2049s1c1
Sequence:CCGGGCCTAAGAGACCACTACAATTCTCGAGAATTGTAGTGGTCTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-834s1c1
Sequence:CCGGGTACTGGAGCTTTGGATGTTTCTCGAGAAACATCCAAAGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1019s1c1
Sequence:CCGGGCTGTTAGGAAGAAATCCCAACTCGAGTTGGGATTTCTTCCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-2107s21c1
Sequence:CCGGCACAAGTCCTAAGGTTGAAAGCTCGAGCTTTCAACCTTAGGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010903.4-2139s21c1
Sequence:CCGGAGCTGTGTCTTGCACTCAAATCTCGAGATTTGAGTGCAAGACACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-1992s21c1
Sequence:CCGGTTAGCTTAGCTAACAAATTTGCTCGAGCAAATTTGTTAGCTAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010903
C6orf222 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 222
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1510s1c1
Sequence:CCGGCCATAAGAAACACACCTCCAACTCGAGTTGGAGGTGTGTTTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-2049s1c1
Sequence:CCGGGCCTAAGAGACCACTACAATTCTCGAGAATTGTAGTGGTCTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-834s1c1
Sequence:CCGGGTACTGGAGCTTTGGATGTTTCTCGAGAAACATCCAAAGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1019s1c1
Sequence:CCGGGCTGTTAGGAAGAAATCCCAACTCGAGTTGGGATTTCTTCCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-2107s21c1
Sequence:CCGGCACAAGTCCTAAGGTTGAAAGCTCGAGCTTTCAACCTTAGGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010903.4-2139s21c1
Sequence:CCGGAGCTGTGTCTTGCACTCAAATCTCGAGATTTGAGTGCAAGACACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-1992s21c1
Sequence:CCGGTTAGCTTAGCTAACAAATTTGCTCGAGCAAATTTGTTAGCTAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010903
C6orf222 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 222
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1510s1c1
Sequence:CCGGCCATAAGAAACACACCTCCAACTCGAGTTGGAGGTGTGTTTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-2049s1c1
Sequence:CCGGGCCTAAGAGACCACTACAATTCTCGAGAATTGTAGTGGTCTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-834s1c1
Sequence:CCGGGTACTGGAGCTTTGGATGTTTCTCGAGAAACATCCAAAGCTCCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010903.1-1019s1c1
Sequence:CCGGGCTGTTAGGAAGAAATCCCAACTCGAGTTGGGATTTCTTCCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-2107s21c1
Sequence:CCGGCACAAGTCCTAAGGTTGAAAGCTCGAGCTTTCAACCTTAGGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010903.4-2139s21c1
Sequence:CCGGAGCTGTGTCTTGCACTCAAATCTCGAGATTTGAGTGCAAGACACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010903.4-1992s21c1
Sequence:CCGGTTAGCTTAGCTAACAAATTTGCTCGAGCAAATTTGTTAGCTAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks