EMAIL THIS PAGE TO A FRIEND

C6orf223

chromosome 6 open reading frame 223

23 Gene Product Result for
Species: Human C6orf223(221416)
UniProtKB ID: Q8N319, E9PB59, Q8N575
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153246 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062421 MISSION® esiRNA esiRNA human C6orf223 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153246 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246284 predicted 997
2 SASI_Hs01_00246285 predicted 1195
3 SASI_Hs01_00246286 predicted 1145
4 SASI_Hs01_00246287 predicted 637
5 SASI_Hs01_00246288 predicted 1113
6 SASI_Hs01_00246289 predicted 601
7 SASI_Hs01_00246290 predicted 1135
8 SASI_Hs01_00246292 predicted 211
9 SASI_Hs01_00246293 predicted 1139
10 SASI_Hs02_00367110 predicted 641
11 SASI_Hs01_00246291 predicted 133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153246
C6orf223 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 223
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-611s21c1
Sequence:CCGGATCGCTTCGCCTCCTACAACACTCGAGTGTTGTAGGAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-235s21c1
Sequence:CCGGTAACCCTAGGTGCCTCCAGTTCTCGAGAACTGGAGGCACCTAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-110s1c1
Sequence:CCGGCCTTACTGATGGTCAGAGCATCTCGAGATGCTCTGACCATCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153246.2-1129s1c1
Sequence:CCGGCGCTCGTTTAACAGTGGCTTTCTCGAGAAAGCCACTGTTAAACGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-620s1c1
Sequence:CCGGCGAGCGCGAGAAGAAATTACACTCGAGTGTAATTTCTTCTCGCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-177s1c1
Sequence:CCGGGAGTGTTTCTGGCAGAAAGAACTCGAGTTCTTTCTGCCAGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-200s1c1
Sequence:CCGGGCACAAGCAAAGATCTGGTAACTCGAGTTACCAGATCTTTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-624s1c1
Sequence:CCGGCGCGAGAAGAAATTACAGGATCTCGAGATCCTGTAATTTCTTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-189s1c1
Sequence:CCGGCAGAAAGAACAGCACAAGCAACTCGAGTTGCTTGTGCTGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153246
C6orf223 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 223
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-611s21c1
Sequence:CCGGATCGCTTCGCCTCCTACAACACTCGAGTGTTGTAGGAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-235s21c1
Sequence:CCGGTAACCCTAGGTGCCTCCAGTTCTCGAGAACTGGAGGCACCTAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-110s1c1
Sequence:CCGGCCTTACTGATGGTCAGAGCATCTCGAGATGCTCTGACCATCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153246.2-1129s1c1
Sequence:CCGGCGCTCGTTTAACAGTGGCTTTCTCGAGAAAGCCACTGTTAAACGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-620s1c1
Sequence:CCGGCGAGCGCGAGAAGAAATTACACTCGAGTGTAATTTCTTCTCGCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-177s1c1
Sequence:CCGGGAGTGTTTCTGGCAGAAAGAACTCGAGTTCTTTCTGCCAGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-200s1c1
Sequence:CCGGGCACAAGCAAAGATCTGGTAACTCGAGTTACCAGATCTTTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-624s1c1
Sequence:CCGGCGCGAGAAGAAATTACAGGATCTCGAGATCCTGTAATTTCTTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-189s1c1
Sequence:CCGGCAGAAAGAACAGCACAAGCAACTCGAGTTGCTTGTGCTGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153246
C6orf223 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 223
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-611s21c1
Sequence:CCGGATCGCTTCGCCTCCTACAACACTCGAGTGTTGTAGGAGGCGAAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153246.4-235s21c1
Sequence:CCGGTAACCCTAGGTGCCTCCAGTTCTCGAGAACTGGAGGCACCTAGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-110s1c1
Sequence:CCGGCCTTACTGATGGTCAGAGCATCTCGAGATGCTCTGACCATCAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153246.2-1129s1c1
Sequence:CCGGCGCTCGTTTAACAGTGGCTTTCTCGAGAAAGCCACTGTTAAACGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-620s1c1
Sequence:CCGGCGAGCGCGAGAAGAAATTACACTCGAGTGTAATTTCTTCTCGCGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-177s1c1
Sequence:CCGGGAGTGTTTCTGGCAGAAAGAACTCGAGTTCTTTCTGCCAGAAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153246.2-200s1c1
Sequence:CCGGGCACAAGCAAAGATCTGGTAACTCGAGTTACCAGATCTTTGCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-624s1c1
Sequence:CCGGCGCGAGAAGAAATTACAGGATCTCGAGATCCTGTAATTTCTTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153246.2-189s1c1
Sequence:CCGGCAGAAAGAACAGCACAAGCAACTCGAGTTGCTTGTGCTGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks