EMAIL THIS PAGE TO A FRIEND

C6orf226

chromosome 6 open reading frame 226

18 Gene Product Result for
Species: Human C6orf226(441150)
UniProtKB ID: Q5I0X4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221201 MISSION® esiRNA esiRNA targeting human C6orf226 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008739 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170609 predicted 261
2 SASI_Hs01_00170610 predicted 265
3 SASI_Hs01_00170611 predicted 296
4 SASI_Hs01_00170612 predicted 293
5 SASI_Hs01_00170613 predicted 213
6 SASI_Hs01_00170614 predicted 294
7 SASI_Hs01_00170615 predicted 267
8 SASI_Hs01_00170616 predicted 295
9 SASI_Hs01_00170617 predicted 291
10 SASI_Hs01_00170618 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008739
VALIDATED
C6orf226 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 226
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-244s21c1
Sequence:CCGGTCCGACCCTCAGGATAGGAACCTCGAGGTTCCTATCCTGAGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-67s21c1
Sequence:CCGGCTCTGCCTCAGCTTCGGTTACCTCGAGGTAACCGAAGCTGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-301s21c1
Sequence:CCGGTGCGCCTTCTTCATGGCATACCTCGAGGTATGCCATGAAGAAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-330s21c1
Sequence:CCGGCCTGAGGTTCCAGGTCCTTTGCTCGAGCAAAGGACCTGGAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-388s21c1
Sequence:CCGGATGCCATTCAGTTACTCATCTCTCGAGAGATGAGTAACTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008739
VALIDATED
C6orf226 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 226
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-244s21c1
Sequence:CCGGTCCGACCCTCAGGATAGGAACCTCGAGGTTCCTATCCTGAGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-67s21c1
Sequence:CCGGCTCTGCCTCAGCTTCGGTTACCTCGAGGTAACCGAAGCTGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-301s21c1
Sequence:CCGGTGCGCCTTCTTCATGGCATACCTCGAGGTATGCCATGAAGAAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-330s21c1
Sequence:CCGGCCTGAGGTTCCAGGTCCTTTGCTCGAGCAAAGGACCTGGAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-388s21c1
Sequence:CCGGATGCCATTCAGTTACTCATCTCTCGAGAGATGAGTAACTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008739
VALIDATED
C6orf226 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 226
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-244s21c1
Sequence:CCGGTCCGACCCTCAGGATAGGAACCTCGAGGTTCCTATCCTGAGGGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-67s21c1
Sequence:CCGGCTCTGCCTCAGCTTCGGTTACCTCGAGGTAACCGAAGCTGAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008739.1-301s21c1
Sequence:CCGGTGCGCCTTCTTCATGGCATACCTCGAGGTATGCCATGAAGAAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-330s21c1
Sequence:CCGGCCTGAGGTTCCAGGTCCTTTGCTCGAGCAAAGGACCTGGAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001008739.1-388s21c1
Sequence:CCGGATGCCATTCAGTTACTCATCTCTCGAGAGATGAGTAACTGAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks