EMAIL THIS PAGE TO A FRIEND

C6orf25

chromosome 6 open reading frame 25

101 Gene Product Result for
Synonyms: G6b NG31
Species: Human C6orf25(80739)
Gene ID:
Human(80739) Summary: This gene is a member of the immunoglobulin (Ig) superfamily and is located in the major histocompatibility complex (MHC) class III region. The protein encoded by this gene is a glycosylated, plasma membrane-bound cell surface receptor, but soluble isoforms encoded by some transcript variants have been found in the endoplasmic reticulum and Golgi before being secreted. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148091 MISSION® esiRNA esiRNA human C6orf25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025260 Rosetta Predictions human pricing
NM_138272 Rosetta Predictions human pricing
NM_138273 Rosetta Predictions human pricing
NM_138274 Rosetta Predictions human pricing
NM_138275 Rosetta Predictions human pricing
NM_138276 Rosetta Predictions human pricing
NM_138277 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129236 predicted 242
2 SASI_Hs01_00129237 predicted 291
3 SASI_Hs01_00129238 predicted 290
4 SASI_Hs01_00129242 predicted 251
5 SASI_Hs01_00129239 predicted 233
6 SASI_Hs01_00129240 predicted 277
7 SASI_Hs01_00129241 predicted 292
8 SASI_Hs01_00129244 predicted 174
9 SASI_Hs01_00129245 predicted 514
10 SASI_Hs02_00358104 predicted 550
11 SASI_Hs01_00129243 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196661 predicted 246
2 SASI_Hs01_00196662 predicted 290
3 SASI_Hs01_00196663 predicted 295
4 SASI_Hs01_00196667 predicted 244
5 SASI_Hs01_00196664 predicted 224
6 SASI_Hs01_00196665 predicted 275
7 SASI_Hs01_00196666 predicted 294
8 SASI_Hs02_00363341 predicted 531
9 SASI_Hs01_00196669 predicted 514
10 SASI_Hs01_00196670 predicted 176
11 SASI_Hs01_00196668 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086690 predicted 244
2 SASI_Hs01_00086691 predicted 295
3 SASI_Hs01_00086692 predicted 424
4 SASI_Hs01_00086693 predicted 344
5 SASI_Hs01_00086694 predicted 430
6 SASI_Hs01_00086695 predicted 291
7 SASI_Hs02_00363342 predicted 245
8 SASI_Hs01_00086696 predicted 426
9 SASI_Hs01_00086697 predicted 230
10 SASI_Hs01_00086698 predicted 268
11 SASI_Hs01_00086699 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122928 predicted 245
2 SASI_Hs01_00122929 predicted 291
3 SASI_Hs01_00122930 predicted 340
4 SASI_Hs01_00122931 predicted 294
5 SASI_Hs02_00363343 predicted 251
6 SASI_Hs01_00122932 predicted 232
7 SASI_Hs01_00122933 predicted 273
8 SASI_Hs01_00122934 predicted 329
9 SASI_Hs01_00122935 predicted 341
10 SASI_Hs01_00122936 predicted 293
11 SASI_Hs01_00122937 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154620 predicted 237
2 SASI_Hs01_00154621 predicted 291
3 SASI_Hs01_00154622 predicted 344
4 SASI_Hs01_00154623 predicted 295
5 SASI_Hs02_00363344 predicted 249
6 SASI_Hs01_00154624 predicted 232
7 SASI_Hs01_00154625 predicted 272
8 SASI_Hs01_00154626 predicted 334
9 SASI_Hs01_00154627 predicted 335
10 SASI_Hs01_00154628 predicted 290
11 SASI_Hs01_00154629 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037799 predicted 242
2 SASI_Hs01_00037800 predicted 299
3 SASI_Hs01_00037801 predicted 295
4 SASI_Hs01_00037802 predicted 239
5 SASI_Hs01_00037803 predicted 283
6 SASI_Hs01_00037804 predicted 299
7 SASI_Hs01_00037805 predicted 254
8 SASI_Hs01_00037806 predicted 272
9 SASI_Hs01_00037807 predicted 536
10 SASI_Hs01_00037808 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212913 predicted 239
2 SASI_Hs01_00212914 predicted 291
3 SASI_Hs01_00212915 predicted 298
4 SASI_Hs01_00212919 predicted 243
5 SASI_Hs01_00212916 predicted 226
6 SASI_Hs01_00212917 predicted 269
7 SASI_Hs01_00212918 predicted 296
8 SASI_Hs01_00212921 predicted 719
9 SASI_Hs01_00212922 predicted 175
10 SASI_Hs02_00363345 predicted 512
11 SASI_Hs01_00212920 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025260
C6orf25 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 25
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-401s21c1
Sequence:CCGGCTACCCATGGGTCCGTGTATCCTCGAGGATACACGGACCCATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-553s21c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-521s21c1
Sequence:CCGGTTCGACCACTCCCTAGATTTGCTCGAGCAAATCTAGGGAGTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-252s21c1
Sequence:CCGGACGCTCCCTGGACTCTGGTATCTCGAGATACCAGAGTCCAGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-527s1c1
Sequence:CCGGCACTCCCTAGATTTGCTCTGTCTCGAGACAGAGCAAATCTAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-553s1c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025260
C6orf25 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 25
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-401s21c1
Sequence:CCGGCTACCCATGGGTCCGTGTATCCTCGAGGATACACGGACCCATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-553s21c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-521s21c1
Sequence:CCGGTTCGACCACTCCCTAGATTTGCTCGAGCAAATCTAGGGAGTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-252s21c1
Sequence:CCGGACGCTCCCTGGACTCTGGTATCTCGAGATACCAGAGTCCAGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-527s1c1
Sequence:CCGGCACTCCCTAGATTTGCTCTGTCTCGAGACAGAGCAAATCTAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-553s1c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025260
C6orf25 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 25
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-401s21c1
Sequence:CCGGCTACCCATGGGTCCGTGTATCCTCGAGGATACACGGACCCATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-553s21c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-521s21c1
Sequence:CCGGTTCGACCACTCCCTAGATTTGCTCGAGCAAATCTAGGGAGTGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025260.2-252s21c1
Sequence:CCGGACGCTCCCTGGACTCTGGTATCTCGAGATACCAGAGTCCAGGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-527s1c1
Sequence:CCGGCACTCCCTAGATTTGCTCTGTCTCGAGACAGAGCAAATCTAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025260.2-553s1c1
Sequence:CCGGCCACATAGCTCCACTTGTGAACTCGAGTTCACAAGTGGAGCTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks