EMAIL THIS PAGE TO A FRIEND

C6orf47

chromosome 6 open reading frame 47

60 Gene Product Result for
Synonyms: D6S53E G4 NG34
Species: Human C6orf47(57827)
UniProtKB ID: O95873, B0UXA1, B0UZ50, Q5SSS6, Q95IG0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021184 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118221 MISSION® esiRNA esiRNA human C6orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021184 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025947 predicted 915
2 SASI_Hs01_00025948 predicted 926
3 SASI_Hs01_00025950 predicted 1117
4 SASI_Hs01_00025951 predicted 1511
5 SASI_Hs01_00025952 predicted 1731
6 SASI_Hs02_00354753 predicted 1111
7 SASI_Hs01_00025953 predicted 1161
8 SASI_Hs02_00354754 predicted 920
9 SASI_Hs01_00025954 predicted 1102
10 SASI_Hs01_00025955 predicted 1531
11 SASI_Hs01_00025949 predicted 1526
12 SASI_Hs01_00025956 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021184
C6orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 47
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021184.3-1108s1c1
Sequence:CCGGCAGCCTATCTCTAGCACTCAACTCGAGTTGAGTGCTAGAGATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1164s21c1
Sequence:CCGGCAAACTCAGATGGGATCATGTCTCGAGACATGATCCCATCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1110s21c1
Sequence:CCGGGCCTATCTCTAGCACTCAAGACTCGAGTCTTGAGTGCTAGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021184.3-2004s21c1
Sequence:CCGGAGTATGATGGTGGTGAATAAACTCGAGTTTATTCACCACCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1263s21c1
Sequence:CCGGGAAACCTGGTAGGCGTGAGAACTCGAGTTCTCACGCCTACCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1525s21c1
Sequence:CCGGGCTGTTCTGAGCCTACTTACTCTCGAGAGTAAGTAGGCTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021184
C6orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 47
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021184.3-1108s1c1
Sequence:CCGGCAGCCTATCTCTAGCACTCAACTCGAGTTGAGTGCTAGAGATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1164s21c1
Sequence:CCGGCAAACTCAGATGGGATCATGTCTCGAGACATGATCCCATCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1110s21c1
Sequence:CCGGGCCTATCTCTAGCACTCAAGACTCGAGTCTTGAGTGCTAGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021184.3-2004s21c1
Sequence:CCGGAGTATGATGGTGGTGAATAAACTCGAGTTTATTCACCACCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1263s21c1
Sequence:CCGGGAAACCTGGTAGGCGTGAGAACTCGAGTTCTCACGCCTACCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1525s21c1
Sequence:CCGGGCTGTTCTGAGCCTACTTACTCTCGAGAGTAAGTAGGCTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021184
C6orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 47
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021184.3-1108s1c1
Sequence:CCGGCAGCCTATCTCTAGCACTCAACTCGAGTTGAGTGCTAGAGATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1164s21c1
Sequence:CCGGCAAACTCAGATGGGATCATGTCTCGAGACATGATCCCATCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1110s21c1
Sequence:CCGGGCCTATCTCTAGCACTCAAGACTCGAGTCTTGAGTGCTAGAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021184.3-2004s21c1
Sequence:CCGGAGTATGATGGTGGTGAATAAACTCGAGTTTATTCACCACCATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1263s21c1
Sequence:CCGGGAAACCTGGTAGGCGTGAGAACTCGAGTTCTCACGCCTACCAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021184.3-1525s21c1
Sequence:CCGGGCTGTTCTGAGCCTACTTACTCTCGAGAGTAAGTAGGCTCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks