EMAIL THIS PAGE TO A FRIEND

C6orf48

chromosome 6 open reading frame 48

26 Gene Product Result for
Synonyms: D6S57 G8
Species: Human C6orf48(50854)
UniProtKB ID: Q9UBA6, Q9BW21, Q9UBA7, Q9UBA8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040437 Rosetta Predictions human pricing
NM_001040438 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031089 predicted 613
2 SASI_Hs01_00031091 predicted 624
3 SASI_Hs01_00031092 predicted 678
4 SASI_Hs01_00031093 predicted 681
5 SASI_Hs01_00031094 predicted 740
6 SASI_Hs01_00031095 predicted 655
7 SASI_Hs01_00031096 predicted 665
8 SASI_Hs01_00031097 predicted 516
9 SASI_Hs01_00031098 predicted 662
10 SASI_Hs02_00308965 predicted 540
11 SASI_Hs01_00031090 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191298 predicted 516
2 SASI_Hs02_00308966 predicted 426
3 SASI_Hs01_00191299 predicted 422
4 SASI_Hs01_00191300 predicted 488
5 SASI_Hs01_00191302 predicted 438
6 SASI_Hs02_00308967 predicted 507
7 SASI_Hs01_00191303 predicted 491
8 SASI_Hs01_00191304 predicted 451
9 SASI_Hs01_00191305 predicted 492
10 SASI_Hs02_00308968 predicted 433
11 SASI_Hs01_00191296 predicted 504
12 SASI_Hs01_00191297 predicted 516
13 SASI_Hs01_00191301 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040438
VALIDATED
C6orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 48
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000322656    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-389s21c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-454s21c1
Sequence:CCGGACAGTGATTCCTGCAACTTGACTCGAGTCAAGTTGCAGGAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-563s21c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-505s21c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040438
VALIDATED
C6orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 48
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000322656    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-389s21c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-454s21c1
Sequence:CCGGACAGTGATTCCTGCAACTTGACTCGAGTCAAGTTGCAGGAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-563s21c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-505s21c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040438
VALIDATED
C6orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 48
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000322656    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-389s21c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-454s21c1
Sequence:CCGGACAGTGATTCCTGCAACTTGACTCGAGTCAAGTTGCAGGAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-563s21c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040438.1-505s21c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016947
VALIDATED
C6orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 48
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-399s1c1
Sequence:CCGGGCTTTGTATGGCTGTCATGCTCTCGAGAGCATGACAGCCATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-528s1c1
Sequence:CCGGCTGGGCATATCCTAAGAACTTCTCGAGAAGTTCTTAGGATATGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-491s1c1
Sequence:CCGGCTATGGAATTTGCTGACACAACTCGAGTTGTGTCAGCAAATTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-532s1c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-396s1c1
Sequence:CCGGGAAGCTTTGTATGGCTGTCATCTCGAGATGACAGCCATACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-474s1c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-358s1c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-349s1c1
Sequence:CCGGCTAATCTGAGTGAAGGTCTAACTCGAGTTAGACCTTCACTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016947
VALIDATED
C6orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 48
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-399s1c1
Sequence:CCGGGCTTTGTATGGCTGTCATGCTCTCGAGAGCATGACAGCCATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-528s1c1
Sequence:CCGGCTGGGCATATCCTAAGAACTTCTCGAGAAGTTCTTAGGATATGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-491s1c1
Sequence:CCGGCTATGGAATTTGCTGACACAACTCGAGTTGTGTCAGCAAATTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-532s1c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-396s1c1
Sequence:CCGGGAAGCTTTGTATGGCTGTCATCTCGAGATGACAGCCATACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-474s1c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-358s1c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-349s1c1
Sequence:CCGGCTAATCTGAGTGAAGGTCTAACTCGAGTTAGACCTTCACTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016947
VALIDATED
C6orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 48
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-399s1c1
Sequence:CCGGGCTTTGTATGGCTGTCATGCTCTCGAGAGCATGACAGCCATACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-528s1c1
Sequence:CCGGCTGGGCATATCCTAAGAACTTCTCGAGAAGTTCTTAGGATATGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-491s1c1
Sequence:CCGGCTATGGAATTTGCTGACACAACTCGAGTTGTGTCAGCAAATTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-532s1c1
Sequence:CCGGGCATATCCTAAGAACTTACAACTCGAGTTGTAAGTTCTTAGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-396s1c1
Sequence:CCGGGAAGCTTTGTATGGCTGTCATCTCGAGATGACAGCCATACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-474s1c1
Sequence:CCGGCCTGTTCTCCTTCCTTGCTATCTCGAGATAGCAAGGAAGGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016947.1-358s1c1
Sequence:CCGGGTGAAGGTCTAAGGTTTGGAACTCGAGTTCCAAACCTTAGACCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016947.1-349s1c1
Sequence:CCGGCTAATCTGAGTGAAGGTCTAACTCGAGTTAGACCTTCACTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks