EMAIL THIS PAGE TO A FRIEND

C6orf52

chromosome 6 open reading frame 52

36 Gene Product Result for
Species: Human C6orf52(347744)
UniProtKB ID: Q5T4I8, Q5T4I7, Q96AS6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051142 Anti-C6ORF52 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145020 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122351 MISSION® esiRNA esiRNA human C6orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718541 Rosetta Predictions human pricing
XM_371798 Rosetta Predictions human pricing
XM_938497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424625 predicted 254
2 SASI_Hs02_00424626 predicted 247
3 SASI_Hs02_00424627 predicted 271
4 SASI_Hs02_00424628 predicted 247
5 SASI_Hs02_00424629 predicted 246
6 SASI_Hs02_00424630 predicted 271
7 SASI_Hs02_00424631 predicted 264
8 SASI_Hs02_00424632 predicted 338
9 SASI_Hs02_00424633 predicted 78
10 SASI_Hs02_00424634 predicted 48
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266424 predicted 249
2 SASI_Hs01_00266425 predicted 240
3 SASI_Hs01_00266426 predicted 262
4 SASI_Hs01_00266427 predicted 247
5 SASI_Hs01_00266428 predicted 247
6 SASI_Hs01_00266429 predicted 271
7 SASI_Hs01_00266430 predicted 261
8 SASI_Hs01_00266431 predicted 338
9 SASI_Hs01_00266433 predicted 80
10 SASI_Hs02_00479359 predicted 47
11 SASI_Hs01_00266432 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483144 predicted 246
2 SASI_Hs02_00483145 predicted 249
3 SASI_Hs02_00483146 predicted 266
4 SASI_Hs02_00483147 predicted 248
5 SASI_Hs02_00483148 predicted 245
6 SASI_Hs02_00483149 predicted 271
7 SASI_Hs02_00483150 predicted 264
8 SASI_Hs02_00483151 predicted 335
9 SASI_Hs02_00483152 predicted 80
10 SASI_Hs02_00483153 predicted 44
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145020
VALIDATED
C6orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 52
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-246s21c1
Sequence:CCGGACCGCTATGGCAACTGGTATGCTCGAGCATACCAGTTGCCATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-274s21c1
Sequence:CCGGGCACGGCTCTTACCTTCTTTCCTCGAGGAAAGAAGGTAAGAGCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145020.1-466s21c1
Sequence:CCGGGGAATCAAACCAAGAGTTTATCTCGAGATAAACTCTTGGTTTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-374s21c1
Sequence:CCGGGGAACTCTGGTTATGCCTAAGCTCGAGCTTAGGCATAACCAGAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-444s21c1
Sequence:CCGGCACATCTTCATTTGAATATTGCTCGAGCAATATTCAAATGAAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145020
VALIDATED
C6orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 52
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-246s21c1
Sequence:CCGGACCGCTATGGCAACTGGTATGCTCGAGCATACCAGTTGCCATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-274s21c1
Sequence:CCGGGCACGGCTCTTACCTTCTTTCCTCGAGGAAAGAAGGTAAGAGCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145020.1-466s21c1
Sequence:CCGGGGAATCAAACCAAGAGTTTATCTCGAGATAAACTCTTGGTTTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-374s21c1
Sequence:CCGGGGAACTCTGGTTATGCCTAAGCTCGAGCTTAGGCATAACCAGAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-444s21c1
Sequence:CCGGCACATCTTCATTTGAATATTGCTCGAGCAATATTCAAATGAAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145020
VALIDATED
C6orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 52
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-246s21c1
Sequence:CCGGACCGCTATGGCAACTGGTATGCTCGAGCATACCAGTTGCCATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-274s21c1
Sequence:CCGGGCACGGCTCTTACCTTCTTTCCTCGAGGAAAGAAGGTAAGAGCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145020.1-466s21c1
Sequence:CCGGGGAATCAAACCAAGAGTTTATCTCGAGATAAACTCTTGGTTTGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-374s21c1
Sequence:CCGGGGAACTCTGGTTATGCCTAAGCTCGAGCTTAGGCATAACCAGAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145020.1-444s21c1
Sequence:CCGGCACATCTTCATTTGAATATTGCTCGAGCAATATTCAAATGAAGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)