EMAIL THIS PAGE TO A FRIEND

C6orf57

chromosome 6 open reading frame 57

18 Gene Product Result for
UniProtKB ID: Q5VUM1, E1P532
Gene ID:
chicken(421870) chromosome 3 open reading frame, human C6orf57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145267 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037011 MISSION® esiRNA esiRNA human C6orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145267 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142762 predicted 235
2 SASI_Hs01_00142763 predicted 205
3 SASI_Hs01_00142764 predicted 236
4 SASI_Hs01_00142765 predicted 204
5 SASI_Hs01_00142766 predicted 198
6 SASI_Hs01_00142767 predicted 203
7 SASI_Hs01_00142761 predicted 197
8 SASI_Hs01_00142768 predicted 290
9 SASI_Hs01_00142769 predicted 156
10 SASI_Hs01_00142770 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145267
VALIDATED
C6orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 57
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-217s21c1
Sequence:CCGGTAGAGAAAGAACCACTGGAAACTCGAGTTTCCAGTGGTTCTTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-96s21c1
Sequence:CCGGCTGTGTCATTCTCTGAGGAAACTCGAGTTTCCTCAGAGAATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-118s21c1
Sequence:CCGGCAAGTTCTTCTCAAGGAGGAACTCGAGTTCCTCCTTGAGAAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145267.2-348s21c1
Sequence:CCGGGTCGCATATTCTTTAACTTCACTCGAGTGAAGTTAAAGAATATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-249s21c1
Sequence:CCGGGATGTTAATCCAGTGACCAAACTCGAGTTTGGTCACTGGATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-294s1c1
Sequence:CCGGGAACCTACCCGATATGGAGATCTCGAGATCTCCATATCGGGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-172s1c1
Sequence:CCGGCGAAGTTACCAGAAGGTCGTTCTCGAGAACGACCTTCTGGTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145267.2-303s1c1
Sequence:CCGGCGATATGGAGATTGGGAACGACTCGAGTCGTTCCCAATCTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-129s1c1
Sequence:CCGGCAAGGAGGAAAGTCTGAACTTCTCGAGAAGTTCAGACTTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-121s1c1
Sequence:CCGGGTTCTTCTCAAGGAGGAAAGTCTCGAGACTTTCCTCCTTGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-173s1c1
Sequence:CCGGGAAGTTACCAGAAGGTCGTTTCTCGAGAAACGACCTTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-144s1c1
Sequence:CCGGGAACTTGTCAAACAGTCCCTTCTCGAGAAGGGACTGTTTGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-160s1c1
Sequence:CCGGCCCTTAAGAAGCCGAAGTTACCTCGAGGTAACTTCGGCTTCTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145267
VALIDATED
C6orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 57
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-217s21c1
Sequence:CCGGTAGAGAAAGAACCACTGGAAACTCGAGTTTCCAGTGGTTCTTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-96s21c1
Sequence:CCGGCTGTGTCATTCTCTGAGGAAACTCGAGTTTCCTCAGAGAATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-118s21c1
Sequence:CCGGCAAGTTCTTCTCAAGGAGGAACTCGAGTTCCTCCTTGAGAAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145267.2-348s21c1
Sequence:CCGGGTCGCATATTCTTTAACTTCACTCGAGTGAAGTTAAAGAATATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-249s21c1
Sequence:CCGGGATGTTAATCCAGTGACCAAACTCGAGTTTGGTCACTGGATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-294s1c1
Sequence:CCGGGAACCTACCCGATATGGAGATCTCGAGATCTCCATATCGGGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-172s1c1
Sequence:CCGGCGAAGTTACCAGAAGGTCGTTCTCGAGAACGACCTTCTGGTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145267.2-303s1c1
Sequence:CCGGCGATATGGAGATTGGGAACGACTCGAGTCGTTCCCAATCTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-129s1c1
Sequence:CCGGCAAGGAGGAAAGTCTGAACTTCTCGAGAAGTTCAGACTTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-121s1c1
Sequence:CCGGGTTCTTCTCAAGGAGGAAAGTCTCGAGACTTTCCTCCTTGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-173s1c1
Sequence:CCGGGAAGTTACCAGAAGGTCGTTTCTCGAGAAACGACCTTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-144s1c1
Sequence:CCGGGAACTTGTCAAACAGTCCCTTCTCGAGAAGGGACTGTTTGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-160s1c1
Sequence:CCGGCCCTTAAGAAGCCGAAGTTACCTCGAGGTAACTTCGGCTTCTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145267
VALIDATED
C6orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 57
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-217s21c1
Sequence:CCGGTAGAGAAAGAACCACTGGAAACTCGAGTTTCCAGTGGTTCTTTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-96s21c1
Sequence:CCGGCTGTGTCATTCTCTGAGGAAACTCGAGTTTCCTCAGAGAATGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-118s21c1
Sequence:CCGGCAAGTTCTTCTCAAGGAGGAACTCGAGTTCCTCCTTGAGAAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145267.2-348s21c1
Sequence:CCGGGTCGCATATTCTTTAACTTCACTCGAGTGAAGTTAAAGAATATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145267.2-249s21c1
Sequence:CCGGGATGTTAATCCAGTGACCAAACTCGAGTTTGGTCACTGGATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-294s1c1
Sequence:CCGGGAACCTACCCGATATGGAGATCTCGAGATCTCCATATCGGGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-172s1c1
Sequence:CCGGCGAAGTTACCAGAAGGTCGTTCTCGAGAACGACCTTCTGGTAACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145267.2-303s1c1
Sequence:CCGGCGATATGGAGATTGGGAACGACTCGAGTCGTTCCCAATCTCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-129s1c1
Sequence:CCGGCAAGGAGGAAAGTCTGAACTTCTCGAGAAGTTCAGACTTTCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-121s1c1
Sequence:CCGGGTTCTTCTCAAGGAGGAAAGTCTCGAGACTTTCCTCCTTGAGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-173s1c1
Sequence:CCGGGAAGTTACCAGAAGGTCGTTTCTCGAGAAACGACCTTCTGGTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145267.2-144s1c1
Sequence:CCGGGAACTTGTCAAACAGTCCCTTCTCGAGAAGGGACTGTTTGACAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145267.2-160s1c1
Sequence:CCGGCCCTTAAGAAGCCGAAGTTACCTCGAGGTAACTTCGGCTTCTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks