EMAIL THIS PAGE TO A FRIEND

C6orf58

chromosome 6 open reading frame 58

18 Gene Product Result for
Species: Human C6orf58(352999)
UniProtKB ID: Q6P5S2, B4E1I0, Q5VUP2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010905 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000971 MISSION® esiRNA esiRNA targeting human C6orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010905 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031279 predicted 574
2 SASI_Hs01_00031280 predicted 904
3 SASI_Hs01_00031281 predicted 284
4 SASI_Hs01_00031282 predicted 213
5 SASI_Hs01_00031283 predicted 676
6 SASI_Hs01_00031284 predicted 900
7 SASI_Hs01_00031285 predicted 345
8 SASI_Hs01_00031286 predicted 902
9 SASI_Hs01_00031287 predicted 769
10 SASI_Hs01_00031288 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010905
C6orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 58
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-762s1c1
Sequence:CCGGCCTCTTTCCTACAACCTTGATCTCGAGATCAAGGTTGTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-871s1c1
Sequence:CCGGCAGAATGTAGTCCTGGTTCTTCTCGAGAAGAACCAGGACTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-546s1c1
Sequence:CCGGCTTCCCTGAGACAATGAACAACTCGAGTTGTTCATTGTCTCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010905.1-877s1c1
Sequence:CCGGGTAGTCCTGGTTCTTCTAAATCTCGAGATTTAGAAGAACCAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-247s1c1
Sequence:CCGGGCACCAGATAATGAACAGAATCTCGAGATTCTGTTCATTATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-968s1c1
Sequence:CCGGCGGAATCTAGCTCTAGAAGTTCTCGAGAACTTCTAGAGCTAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-732s21c1
Sequence:CCGGGGTACTGGCTGTGGATCATTTCTCGAGAAATGATCCACAGCCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-614s21c1
Sequence:CCGGATGATCTGTTGAAGTACTTATCTCGAGATAAGTACTTCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-216s21c1
Sequence:CCGGGAATCAGACAGCCAGGTATTTCTCGAGAAATACCTGGCTGTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010905
C6orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 58
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-762s1c1
Sequence:CCGGCCTCTTTCCTACAACCTTGATCTCGAGATCAAGGTTGTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-871s1c1
Sequence:CCGGCAGAATGTAGTCCTGGTTCTTCTCGAGAAGAACCAGGACTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-546s1c1
Sequence:CCGGCTTCCCTGAGACAATGAACAACTCGAGTTGTTCATTGTCTCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010905.1-877s1c1
Sequence:CCGGGTAGTCCTGGTTCTTCTAAATCTCGAGATTTAGAAGAACCAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-247s1c1
Sequence:CCGGGCACCAGATAATGAACAGAATCTCGAGATTCTGTTCATTATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-968s1c1
Sequence:CCGGCGGAATCTAGCTCTAGAAGTTCTCGAGAACTTCTAGAGCTAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-732s21c1
Sequence:CCGGGGTACTGGCTGTGGATCATTTCTCGAGAAATGATCCACAGCCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-614s21c1
Sequence:CCGGATGATCTGTTGAAGTACTTATCTCGAGATAAGTACTTCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-216s21c1
Sequence:CCGGGAATCAGACAGCCAGGTATTTCTCGAGAAATACCTGGCTGTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010905
C6orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 58
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-762s1c1
Sequence:CCGGCCTCTTTCCTACAACCTTGATCTCGAGATCAAGGTTGTAGGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-871s1c1
Sequence:CCGGCAGAATGTAGTCCTGGTTCTTCTCGAGAAGAACCAGGACTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-546s1c1
Sequence:CCGGCTTCCCTGAGACAATGAACAACTCGAGTTGTTCATTGTCTCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010905.1-877s1c1
Sequence:CCGGGTAGTCCTGGTTCTTCTAAATCTCGAGATTTAGAAGAACCAGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-247s1c1
Sequence:CCGGGCACCAGATAATGAACAGAATCTCGAGATTCTGTTCATTATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010905.1-968s1c1
Sequence:CCGGCGGAATCTAGCTCTAGAAGTTCTCGAGAACTTCTAGAGCTAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-732s21c1
Sequence:CCGGGGTACTGGCTGTGGATCATTTCTCGAGAAATGATCCACAGCCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-614s21c1
Sequence:CCGGATGATCTGTTGAAGTACTTATCTCGAGATAAGTACTTCAACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010905.1-216s21c1
Sequence:CCGGGAATCAGACAGCCAGGTATTTCTCGAGAAATACCTGGCTGTCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks